ID: 1174374005

View in Genome Browser
Species Human (GRCh38)
Location 20:50113223-50113245
Sequence GCCGCCGCTGACGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174373994_1174374005 28 Left 1174373994 20:50113172-50113194 CCCTTACCCGTCCCCCGGCCCTG 0: 1
1: 0
2: 0
3: 14
4: 284
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373993_1174374005 29 Left 1174373993 20:50113171-50113193 CCCCTTACCCGTCCCCCGGCCCT 0: 1
1: 0
2: 1
3: 29
4: 384
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373996_1174374005 22 Left 1174373996 20:50113178-50113200 CCCGTCCCCCGGCCCTGATGCGC 0: 1
1: 0
2: 2
3: 13
4: 165
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373995_1174374005 27 Left 1174373995 20:50113173-50113195 CCTTACCCGTCCCCCGGCCCTGA 0: 1
1: 0
2: 0
3: 16
4: 244
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174374003_1174374005 10 Left 1174374003 20:50113190-50113212 CCCTGATGCGCAGGCGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373992_1174374005 30 Left 1174373992 20:50113170-50113192 CCCCCTTACCCGTCCCCCGGCCC 0: 1
1: 0
2: 1
3: 41
4: 573
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373999_1174374005 17 Left 1174373999 20:50113183-50113205 CCCCCGGCCCTGATGCGCAGGCG 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174374001_1174374005 15 Left 1174374001 20:50113185-50113207 CCCGGCCCTGATGCGCAGGCGCG 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174373997_1174374005 21 Left 1174373997 20:50113179-50113201 CCGTCCCCCGGCCCTGATGCGCA 0: 1
1: 0
2: 3
3: 8
4: 155
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174374002_1174374005 14 Left 1174374002 20:50113186-50113208 CCGGCCCTGATGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174374004_1174374005 9 Left 1174374004 20:50113191-50113213 CCTGATGCGCAGGCGCGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data
1174374000_1174374005 16 Left 1174374000 20:50113184-50113206 CCCCGGCCCTGATGCGCAGGCGC 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174374005 Original CRISPR GCCGCCGCTGACGCCCGCCC CGG Intronic