ID: 1174384605

View in Genome Browser
Species Human (GRCh38)
Location 20:50179674-50179696
Sequence CCTGAAGTCCAGCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174384598_1174384605 8 Left 1174384598 20:50179643-50179665 CCAGTAGGGTGGATGGAGTGAGG No data
Right 1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174384605 Original CRISPR CCTGAAGTCCAGCTGGAGCC TGG Intergenic
No off target data available for this crispr