ID: 1174386095

View in Genome Browser
Species Human (GRCh38)
Location 20:50189451-50189473
Sequence CTTGCCCGCCTCTGCTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174386095_1174386105 17 Left 1174386095 20:50189451-50189473 CCTACCCAGCAGAGGCGGGCAAG No data
Right 1174386105 20:50189491-50189513 GCCTGTGTTCAAGTCCAGGCGGG No data
1174386095_1174386104 16 Left 1174386095 20:50189451-50189473 CCTACCCAGCAGAGGCGGGCAAG No data
Right 1174386104 20:50189490-50189512 GGCCTGTGTTCAAGTCCAGGCGG No data
1174386095_1174386103 13 Left 1174386095 20:50189451-50189473 CCTACCCAGCAGAGGCGGGCAAG No data
Right 1174386103 20:50189487-50189509 TTGGGCCTGTGTTCAAGTCCAGG No data
1174386095_1174386100 -6 Left 1174386095 20:50189451-50189473 CCTACCCAGCAGAGGCGGGCAAG No data
Right 1174386100 20:50189468-50189490 GGCAAGTGGTCAGAAGGCCTTGG No data
1174386095_1174386101 -5 Left 1174386095 20:50189451-50189473 CCTACCCAGCAGAGGCGGGCAAG No data
Right 1174386101 20:50189469-50189491 GCAAGTGGTCAGAAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174386095 Original CRISPR CTTGCCCGCCTCTGCTGGGT AGG (reversed) Intergenic
No off target data available for this crispr