ID: 1174386443

View in Genome Browser
Species Human (GRCh38)
Location 20:50190706-50190728
Sequence CGCGGCCGCCCGAGACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174386443_1174386456 15 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386456 20:50190744-50190766 TCCCGGCGGCGCGGCGGGAGGGG 0: 1
1: 0
2: 1
3: 40
4: 266
1174386443_1174386459 19 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386459 20:50190748-50190770 GGCGGCGCGGCGGGAGGGGCCGG 0: 1
1: 1
2: 29
3: 208
4: 1793
1174386443_1174386455 14 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386455 20:50190743-50190765 GTCCCGGCGGCGCGGCGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 201
1174386443_1174386452 9 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386452 20:50190738-50190760 TTCGCGTCCCGGCGGCGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 58
1174386443_1174386447 -2 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386447 20:50190727-50190749 CGGCCGTGTCCTTCGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
1174386443_1174386454 13 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386454 20:50190742-50190764 CGTCCCGGCGGCGCGGCGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 286
1174386443_1174386453 10 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386453 20:50190739-50190761 TCGCGTCCCGGCGGCGCGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 103
1174386443_1174386450 6 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386450 20:50190735-50190757 TCCTTCGCGTCCCGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 47
1174386443_1174386449 1 Left 1174386443 20:50190706-50190728 CCCGGGGGTCTCGGGCGGCCGCG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1174386449 20:50190730-50190752 CCGTGTCCTTCGCGTCCCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174386443 Original CRISPR CGCGGCCGCCCGAGACCCCC GGG (reversed) Intergenic
902350219 1:15848367-15848389 CGCGGCCGCCGGGGCCCCGCGGG - Intronic
903828644 1:26161951-26161973 CGCCGCCGCCCGCGCCGCCCGGG - Exonic
904253063 1:29238040-29238062 CCCGGCCGGCCGGGACCGCCAGG + Intronic
904604518 1:31691439-31691461 CCCGGCCTCCCTGGACCCCCTGG - Exonic
905168677 1:36098089-36098111 CCCGGGCCCCCGGGACCCCCTGG - Exonic
905639239 1:39576986-39577008 CGCGGCTGCGGGAGACCCCAGGG + Intergenic
905734352 1:40315624-40315646 CGGGGCCCCCCGGGTCCCCCGGG - Exonic
919809395 1:201399322-201399344 CGTGGCCGCCCGCGCCCCGCCGG + Exonic
920924527 1:210329080-210329102 CGCCGCCGCCCGGGACAGCCCGG + Exonic
922116442 1:222618284-222618306 CGGGGCCGGCGGAGACCCCAAGG - Intronic
922505158 1:226121947-226121969 CGCGGCCGCCAGACCCCGCCCGG + Intergenic
923055849 1:230425717-230425739 CGCGAGCCCCCGGGACCCCCAGG - Intronic
923107837 1:230868254-230868276 CCCGGCGCCCCGAGACCCCGGGG - Exonic
923126687 1:231039995-231040017 CGCCGCCGCCCGGGCCCCCGCGG + Exonic
923630253 1:235644974-235644996 CCGGGCCGCCAGAGACCCCAGGG + Intronic
1064086247 10:12348848-12348870 CGCGGCTGCCAAACACCCCCGGG + Intergenic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064209005 10:13347888-13347910 CCGGGCCGCCCGGGACCGCCGGG - Intronic
1065727357 10:28678271-28678293 CCCGGCCGCCCGAGCCCCCAGGG - Intronic
1069019123 10:63465919-63465941 CGCGGCCGTCGAAGACCCCGAGG + Intergenic
1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG + Intergenic
1075697772 10:124448877-124448899 TGCGGCCGCCAGAGGCGCCCCGG + Intronic
1076809326 10:132878507-132878529 CACGCCTGCCCCAGACCCCCAGG - Intronic
1077052818 11:575472-575494 AGCGGGCGCCAGAGACCCGCGGG - Intergenic
1077052836 11:575528-575550 CGCGGACTCGCGAGACCCCCTGG - Intergenic
1077085379 11:747452-747474 CGCCGCCGCCGCAGACCCCTCGG + Exonic
1082001387 11:47395316-47395338 CGCCATCCCCCGAGACCCCCGGG + Intergenic
1082784953 11:57311623-57311645 CGCAGCCCCCAGAGGCCCCCTGG + Intronic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1083794675 11:65008556-65008578 CGCTGCCGCCCACCACCCCCAGG + Intergenic
1085312706 11:75525717-75525739 CGCGGCGGCCGGAGCCCCGCGGG + Exonic
1091402404 12:188993-189015 CTCTGCTGCCCCAGACCCCCTGG - Intergenic
1092843349 12:12562972-12562994 CGCGCCCGCCCCCTACCCCCGGG + Intergenic
1096462411 12:51829292-51829314 CCAGGCAGCCAGAGACCCCCTGG - Intergenic
1097262343 12:57726761-57726783 CGTGGCGGCCCGTGACGCCCAGG - Exonic
1097284290 12:57865541-57865563 CGCGGCCGCCAGACCCTCCCCGG + Intergenic
1101716962 12:107319897-107319919 CGCGGCCGCCGCAGTCCCGCCGG + Exonic
1103764405 12:123270933-123270955 CGCTCCCGGCCGAGGCCCCCGGG + Intronic
1106226318 13:27789787-27789809 CGCGGCCGCCCGAGAGAGCCCGG + Intergenic
1107931608 13:45311881-45311903 TGCTGCGGCCAGAGACCCCCTGG - Intergenic
1112091893 13:96091098-96091120 CGCGGCCCCCCGAGGTCCCTCGG - Exonic
1113379011 13:109786329-109786351 CGGCGCCGCCCGAGAGCCCGAGG - Exonic
1113437900 13:110307396-110307418 AGGGGCCGCCCGAGCCCCCGGGG + Exonic
1119382926 14:74240128-74240150 CGCGGCCGCCCGAAACGCTTGGG - Intronic
1122131244 14:99605272-99605294 GGCGGCCTCGCGGGACCCCCGGG + Intergenic
1122688987 14:103522734-103522756 CGCGGACGCCCCCGGCCCCCGGG + Intronic
1122920289 14:104877135-104877157 CCCAGCAGCCTGAGACCCCCTGG - Intronic
1122974944 14:105167290-105167312 GGCGCCCGCCCGTGCCCCCCAGG + Intronic
1127488140 15:59438081-59438103 CGCGGCGGCTCGCGCCCCCCGGG + Intronic
1128264632 15:66255154-66255176 CGCTGCGGCCCGACACCACCAGG + Intergenic
1128344093 15:66842711-66842733 CCGGGCCGCCCGTGACCCCCCGG - Intergenic
1128423957 15:67521134-67521156 CGCGGGTGCCCGAGAGCCCCCGG - Exonic
1129271480 15:74421511-74421533 CACGGCCTCCCATGACCCCCAGG + Intronic
1130390115 15:83447624-83447646 TGCGGCCCCCCGAGGCTCCCGGG + Intronic
1132500595 16:283044-283066 TGCGGCCGCCCCCGGCCCCCAGG - Intergenic
1135517656 16:23149127-23149149 CGCGGCCGGCCCGGACGCCCCGG + Exonic
1136498383 16:30657927-30657949 CGCGGCCGCTCGGGCCACCCCGG + Intergenic
1137732613 16:50699726-50699748 CGCGGCTGCCCAAGAAGCCCAGG + Exonic
1138105634 16:54285972-54285994 CGCTGCCGCCAGCGGCCCCCGGG + Exonic
1139504090 16:67390448-67390470 CGTGGCCACCCGAGACCAGCAGG + Intronic
1140223103 16:73058176-73058198 GCCGGCCGCCGGCGACCCCCGGG - Intronic
1142202666 16:88768557-88768579 CAGGGCCACCCGGGACCCCCGGG - Intronic
1142374866 16:89701637-89701659 CGCGGCGGCCGGAGACCGCTGGG - Exonic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1143590760 17:7884990-7885012 CGCGACCGCCACAGCCCCCCCGG + Exonic
1146403668 17:32519457-32519479 CGCCGCCGCCAGAGCCCACCCGG - Intronic
1146646681 17:34581082-34581104 CGCCGCGGCCCGACATCCCCGGG - Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147184457 17:38705806-38705828 CGCGCCCTCCGGAGACCTCCTGG + Intronic
1148021804 17:44558225-44558247 CGCCGCCGCCCGGGCCACCCGGG - Exonic
1150007238 17:61477364-61477386 CGCGGCTGCCAGAGCCCCCGGGG - Intronic
1150069664 17:62140102-62140124 CCAGGCCCCCCGAGAGCCCCTGG - Intergenic
1150250236 17:63700667-63700689 CTCGGCCGCCCGAGGGACCCCGG - Intronic
1152593169 17:81223394-81223416 CTCGGCTCCCCGACACCCCCAGG + Intergenic
1152933754 17:83124263-83124285 CACGGCTGCCCGAGCCCTCCAGG - Intergenic
1155054568 18:22172041-22172063 CGCGGCCGCCCATGGCCGCCAGG - Exonic
1155152801 18:23135899-23135921 AGCCGCCGCCCGAACCCCCCCGG + Exonic
1160242393 18:77132898-77132920 CGCGGCCGCCGGCGCCGCCCCGG + Intronic
1160533190 18:79577275-79577297 CGTGGCCCACGGAGACCCCCTGG + Intergenic
1160684030 19:425184-425206 GGCGGACGCCCGGGGCCCCCCGG - Exonic
1160729287 19:633433-633455 TGCGGCCGCCCGGGACTCCCCGG - Exonic
1160865538 19:1254370-1254392 CAGTGCCGCCCGAGTCCCCCCGG + Exonic
1160876677 19:1299775-1299797 AGCGGCCGCCCGAACCCCACTGG - Intronic
1160957389 19:1699844-1699866 TGTGGCCCCCCAAGACCCCCAGG - Intergenic
1161175824 19:2841709-2841731 CGGGGCCGGGCGGGACCCCCGGG - Intronic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161590075 19:5125557-5125579 CGCTCCCTCCCGAGATCCCCGGG + Intronic
1164402041 19:27909500-27909522 CGGGACCGCCCCAGAGCCCCTGG - Intergenic
1165129646 19:33623542-33623564 CACCGCCGCCCAAGGCCCCCAGG + Intronic
1165328052 19:35125540-35125562 CACGGCCCCCAGAGACCCCCGGG - Intronic
1165712865 19:38024514-38024536 CCGGGCTCCCCGAGACCCCCAGG - Intronic
1166765774 19:45251555-45251577 CCCGGCCGCCCCTGCCCCCCGGG + Exonic
1167648926 19:50719367-50719389 CGCAGCTGCCCCAAACCCCCAGG + Intronic
1168125164 19:54278827-54278849 CTCGGCCCCCAGCGACCCCCTGG - Exonic
1168145712 19:54419216-54419238 GCCGGCCCCCCGAGCCCCCCGGG + Exonic
1168166553 19:54552219-54552241 CTCGGCCCCCAGGGACCCCCTGG + Intergenic
927713823 2:25340924-25340946 CGCGGCCGCCCGGGCACCCACGG + Intronic
929646959 2:43637458-43637480 CTCGGCCCCGCGAGCCCCCCTGG - Intronic
933847536 2:86337693-86337715 GGCGGCGGCCCCAGCCCCCCGGG + Intronic
935013223 2:99155109-99155131 CGCGCGCGCCCAAGACCCCACGG - Intronic
941816300 2:169799141-169799163 CGCCGCCGCCCGCGCCCCCTCGG - Intronic
942438094 2:176002586-176002608 CGCGGCGGTCTGAGACCACCAGG - Intronic
942928191 2:181457729-181457751 GGCGGCCGGTCGGGACCCCCAGG - Exonic
945080864 2:206085498-206085520 CGCGCCCCCTCGAGTCCCCCGGG - Intronic
946311291 2:218883779-218883801 AGCGGCTGCCCGGGACCCCCGGG + Intronic
946359861 2:219212811-219212833 CGCAGCCGGCCGAGGCCCACTGG + Intronic
946702066 2:222424364-222424386 CGGGGCCGCCCAAGCCCTCCGGG + Intergenic
948393392 2:237627762-237627784 CGCGCCCGCCCGGCGCCCCCCGG - Intronic
948456070 2:238105216-238105238 CCCTGCCGCCTGAGATCCCCAGG + Intronic
948645147 2:239400198-239400220 CCCGCCCTCCCGCGACCCCCCGG + Intronic
1170629959 20:18057580-18057602 AGCTGCGGACCGAGACCCCCAGG + Exonic
1173243485 20:41317800-41317822 CGCGGCCGCCAGAGGCGACCTGG - Intergenic
1174386443 20:50190706-50190728 CGCGGCCGCCCGAGACCCCCGGG - Intergenic
1174393809 20:50233902-50233924 CGCCTCCCCCAGAGACCCCCAGG - Intergenic
1174395225 20:50243130-50243152 CCCGGCCCCCGCAGACCCCCTGG + Intergenic
1175108504 20:56630376-56630398 CCCGGCGCCCCGAGACCCCTGGG + Intronic
1176152498 20:63599202-63599224 CGTGGCCGCTCCTGACCCCCCGG + Intronic
1176194645 20:63831466-63831488 CGCGGCCCCCTGCGACCCCGCGG - Intergenic
1176207274 20:63895648-63895670 CGCGGCCGCCCCCAACCCCCCGG + Intronic
1179183261 21:39062693-39062715 CGCAGCCGCTCCAGATCCCCTGG - Intergenic
1179657351 21:42853498-42853520 AGCTGCCGCCCCACACCCCCAGG + Intronic
1179906755 21:44426710-44426732 CGCGGCCGCCATGGACCCCATGG + Exonic
1180014766 21:45074811-45074833 CGCGCCCGCCCGAGCCGCCGCGG - Intronic
1180109647 21:45642179-45642201 CGCGGCCCCCCGAGCACCCCCGG - Intergenic
1181631964 22:24156206-24156228 GGCGGCCGCCAGAGCCCACCAGG - Intronic
1181831495 22:25564387-25564409 CGGGGCCACCCCAGACCTCCCGG + Intergenic
1184382660 22:44155553-44155575 CGTGGCCACCCCAGACCTCCTGG + Intronic
1184557426 22:45240899-45240921 CGCCGCCGCCCGCGCGCCCCCGG + Intergenic
1185038349 22:48490906-48490928 CGCGGCTGCCCGGGTCTCCCTGG - Intronic
1185206372 22:49541418-49541440 CGCTGCCTCCCGAGGGCCCCGGG + Intronic
1185278655 22:49960734-49960756 CGCCGCGGCCCAAAACCCCCGGG + Exonic
1185398520 22:50604463-50604485 CGGGGCCGCCCAGGACTCCCAGG + Exonic
950525247 3:13519353-13519375 TGCTGCCGCCCGATACCCACAGG + Intergenic
953909245 3:46883413-46883435 CCCGGCGGCCCGAGGCCCCGGGG - Exonic
955687575 3:61562138-61562160 CTCGGCGGCCCGAGTCCCCTTGG - Exonic
961402040 3:126654637-126654659 CGCCGCAGCCCGGGACCCGCGGG + Intronic
966732711 3:183163718-183163740 CGCGGCTGCCGCAGACTCCCTGG - Intronic
966887853 3:184386636-184386658 CGGGGCCGCCCAGGACCACCAGG - Exonic
966904717 3:184513834-184513856 CGCGGACGCCGGAGTCCCCCTGG + Intronic
968046177 3:195624916-195624938 CGCAGCCCCCAGAGGCCCCCGGG + Intergenic
968308477 3:197665171-197665193 CGCAGCCCCCAGAGGCCCCCGGG - Intergenic
968746885 4:2364964-2364986 CGCGTGCGCCCGGGACACCCCGG - Intronic
968965269 4:3766303-3766325 CGGGGCCGCGCGAGGACCCCGGG + Intergenic
969912197 4:10457182-10457204 CGCGGCCGCTCGACCCGCCCCGG + Intronic
974009301 4:56592696-56592718 GGCGGCCGCCCCCGACCCCGCGG - Intronic
976704656 4:88007916-88007938 GGCGGCCGCGCGGGACCCCCCGG + Exonic
979582781 4:122379603-122379625 GGCGGCCGCCTGCGAGCCCCCGG + Intronic
981920121 4:150078183-150078205 CGGGGCTGCCCGGGACCCGCAGG + Intergenic
984928186 4:184825393-184825415 CGCGGCGGCACGAGGCCCACAGG - Intronic
985747134 5:1653959-1653981 CGCAGCCCCCAGAGGCCCCCGGG - Intergenic
986747916 5:10760764-10760786 CGCGGCCGCCCGCGGTCCTCAGG + Intronic
988509725 5:31855000-31855022 GGCAGCCGCCCCAGGCCCCCGGG + Intronic
989576454 5:42992654-42992676 CGCCGCCGCCCGGGAACGCCAGG - Intergenic
991371527 5:65925451-65925473 CCCGGACTCCCGAGCCCCCCAGG - Intergenic
991391053 5:66144156-66144178 CGCAGCCGCGCGAGAACCGCCGG + Intronic
996082073 5:119268036-119268058 AGGGGCCACCCGAGACCGCCAGG - Intergenic
997177744 5:131796849-131796871 CGCGCCCGGCCGCGACGCCCGGG - Exonic
997470621 5:134115110-134115132 CGCCGGCCCCCGGGACCCCCGGG - Exonic
998134664 5:139668384-139668406 CGCGGCCGCCAGAGCCGCGCAGG - Intronic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1001826812 5:174751755-174751777 CGCGGCCGCCCAAGAGCCCCGGG - Intergenic
1002455898 5:179345215-179345237 CGCCGCCGCCCGCGAACGCCAGG - Exonic
1002888012 6:1312761-1312783 CGCTGCCGCCCGCGCCCTCCAGG - Exonic
1003139306 6:3457233-3457255 CGCCGCCGCCCGGGATCCACGGG + Intergenic
1003290734 6:4776478-4776500 CGCGCCCGCCCCAGCCCGCCCGG + Exonic
1004627966 6:17394060-17394082 CGCGGCCGCCCGCCAACCCCGGG - Intronic
1006491578 6:34392515-34392537 CGCGGCCGCCTCATTCCCCCAGG + Exonic
1007072673 6:39048675-39048697 TCCGGCCGCCAGAGACCCCTGGG - Intergenic
1013366301 6:109440758-109440780 CGCGGGCGGCCGCGACCGCCGGG + Exonic
1013619334 6:111873043-111873065 CGGGCCCGCCGGGGACCCCCCGG - Exonic
1014535741 6:122610929-122610951 CGCGGCCGCTCGTGACTACCCGG - Intronic
1016010754 6:139135515-139135537 CGCCGCCGCCAGGGCCCCCCCGG - Exonic
1016330079 6:142945885-142945907 CGCGGCGGCCCGAGCCCCAGCGG + Intergenic
1016340890 6:143060752-143060774 CGCGGCCGCGCCAGTCCCCGGGG + Intronic
1016994912 6:149954733-149954755 CGCTGCCGGCCGATACCCCCGGG - Intergenic
1017003697 6:150014703-150014725 CGCTGCCGGCCGATACCCCCGGG + Intergenic
1018017819 6:159727621-159727643 CCCTGCCGCCCGGGCCCCCCGGG - Intronic
1019088331 6:169502239-169502261 CGCGGCCGCGGGAGACACCCAGG + Intronic
1019328604 7:451963-451985 CGCTGCCCCCAGAGACCTCCAGG - Intergenic
1019485393 7:1287081-1287103 CCCGGCCGTCTGTGACCCCCTGG - Intergenic
1019534923 7:1523858-1523880 CGGGGCCACCTGAGTCCCCCGGG + Intergenic
1022090063 7:27102210-27102232 TGCAGCCGCCCGAGTACCCCTGG - Exonic
1022094711 7:27131171-27131193 CGCGGCCGCCAGACAGCCCGAGG - Intronic
1023035810 7:36130613-36130635 AGCAGCCTCCCCAGACCCCCAGG - Intergenic
1023530607 7:41149712-41149734 CGCGGCTGCTCCAGGCCCCCTGG + Intergenic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1027048044 7:75004088-75004110 CCCAGCTGCCCGAGAGCCCCGGG - Intronic
1029384953 7:100237527-100237549 CCCAGCTGCCCGAGAGCCCCGGG + Intronic
1032298931 7:130668814-130668836 CCCGGCCGCCCTCGGCCCCCGGG + Exonic
1033361311 7:140640659-140640681 CCCGGCCGCCCGCAAGCCCCTGG + Exonic
1034129178 7:148699409-148699431 CGCGGACGCCCGAGCCGCCCCGG - Intronic
1034263878 7:149772433-149772455 CGGGTCAGCCCTAGACCCCCAGG - Intronic
1034347623 7:150397114-150397136 CGCGCACGCCCGGGACCGCCAGG + Exonic
1034618013 7:152435826-152435848 CGCGGCGGCGGGAGCCCCCCAGG - Exonic
1038632797 8:29262532-29262554 CGGGACCGCCCGGGACCCCCCGG - Intronic
1039996782 8:42541371-42541393 CGCCGCCTCCCGCGAGCCCCCGG - Intronic
1042040214 8:64581378-64581400 CGCCGCCGCCCAGGCCCCCCGGG - Exonic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1049585220 8:143429881-143429903 CGCCGCCGCCCGCGAAGCCCGGG + Exonic
1049741324 8:144242428-144242450 CGTGGCGGCCCGGGCCCCCCGGG + Exonic
1050537781 9:6645439-6645461 GGCGGCCGCCCCCGACCCCGCGG + Exonic
1050744152 9:8857774-8857796 CGCCGCCGCCGAAGCCCCCCTGG + Intronic
1055829309 9:80360116-80360138 CGCGCCTGCCCGGGACACCCAGG - Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1057488789 9:95506696-95506718 CGCGGCCACCCGCGCCCCCACGG - Intronic
1060208958 9:121699015-121699037 CGAGGCTGCCCGAGCCCCCCGGG - Intronic
1060407630 9:123380781-123380803 CAAGGCAGCCCAAGACCCCCTGG + Exonic
1061129859 9:128702769-128702791 CGCCCCCTCCCGAGACCCGCTGG - Exonic
1061843960 9:133376329-133376351 CGCGCTGGCCCCAGACCCCCAGG - Intergenic
1061975593 9:134066916-134066938 CTCGGCCCGCCGAGACCCACCGG - Intronic
1062574559 9:137200208-137200230 CGCCGCCGCCCGCGCCGCCCCGG - Exonic
1185678136 X:1865475-1865497 TGCGCCCGGCCGAGACCTCCAGG + Intergenic
1186496424 X:10015484-10015506 CGCGGCCGCCCCCGCGCCCCGGG + Intergenic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic
1199881128 X:151974819-151974841 CGCGCCCGCGCGAGCCTCCCCGG - Intergenic
1200100758 X:153688306-153688328 CGCCGCCGCCCGCGCGCCCCCGG + Exonic