ID: 1174386738

View in Genome Browser
Species Human (GRCh38)
Location 20:50191786-50191808
Sequence GGCCGCGCCGGCGCCCTCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 300}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174386722_1174386738 24 Left 1174386722 20:50191739-50191761 CCGAGCCCCGCTGACGCCAAGGC 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386725_1174386738 17 Left 1174386725 20:50191746-50191768 CCGCTGACGCCAAGGCGCCCCCG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386723_1174386738 19 Left 1174386723 20:50191744-50191766 CCCCGCTGACGCCAAGGCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386732_1174386738 -2 Left 1174386732 20:50191765-50191787 CCCGACCGCCTGCTACGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386726_1174386738 8 Left 1174386726 20:50191755-50191777 CCAAGGCGCCCCCGACCGCCTGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386724_1174386738 18 Left 1174386724 20:50191745-50191767 CCCGCTGACGCCAAGGCGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386730_1174386738 -1 Left 1174386730 20:50191764-50191786 CCCCGACCGCCTGCTACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386736_1174386738 -10 Left 1174386736 20:50191773-50191795 CCTGCTACGCGGGGGCCGCGCCG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386735_1174386738 -7 Left 1174386735 20:50191770-50191792 CCGCCTGCTACGCGGGGGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386734_1174386738 -3 Left 1174386734 20:50191766-50191788 CCGACCGCCTGCTACGCGGGGGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300
1174386728_1174386738 0 Left 1174386728 20:50191763-50191785 CCCCCGACCGCCTGCTACGCGGG 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174386738 Original CRISPR GGCCGCGCCGGCGCCCTCGC AGG Exonic