ID: 1174387554

View in Genome Browser
Species Human (GRCh38)
Location 20:50196350-50196372
Sequence CTTCCTAGGAGGGGCCTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174387554_1174387569 26 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387569 20:50196399-50196421 CCAGGGAGTCAGGAGTATGGTGG No data
1174387554_1174387562 16 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387562 20:50196389-50196411 ACCCCTGAGCCCAGGGAGTCAGG No data
1174387554_1174387560 8 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387560 20:50196381-50196403 GAGCAGAGACCCCTGAGCCCAGG No data
1174387554_1174387566 23 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387566 20:50196396-50196418 AGCCCAGGGAGTCAGGAGTATGG No data
1174387554_1174387561 9 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387561 20:50196382-50196404 AGCAGAGACCCCTGAGCCCAGGG No data
1174387554_1174387570 27 Left 1174387554 20:50196350-50196372 CCTGCGAGGCCCCTCCTAGGAAG No data
Right 1174387570 20:50196400-50196422 CAGGGAGTCAGGAGTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174387554 Original CRISPR CTTCCTAGGAGGGGCCTCGC AGG (reversed) Intergenic
No off target data available for this crispr