ID: 1174392532

View in Genome Browser
Species Human (GRCh38)
Location 20:50226754-50226776
Sequence CCTCCTAGGGAGCAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174392524_1174392532 4 Left 1174392524 20:50226727-50226749 CCACTGCCTTTTCTGATTGCTAA No data
Right 1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG No data
1174392522_1174392532 23 Left 1174392522 20:50226708-50226730 CCTCCTTTTCTTGGTAAAACCAC No data
Right 1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG No data
1174392525_1174392532 -2 Left 1174392525 20:50226733-50226755 CCTTTTCTGATTGCTAAAGCTCC No data
Right 1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG No data
1174392523_1174392532 20 Left 1174392523 20:50226711-50226733 CCTTTTCTTGGTAAAACCACTGC No data
Right 1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174392532 Original CRISPR CCTCCTAGGGAGCAGGTGGG TGG Intergenic
No off target data available for this crispr