ID: 1174392913

View in Genome Browser
Species Human (GRCh38)
Location 20:50228904-50228926
Sequence CTGGTTGGATAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174392913_1174392923 22 Left 1174392913 20:50228904-50228926 CCTTTTTCCCTCTATCCAACCAG No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392913_1174392922 21 Left 1174392913 20:50228904-50228926 CCTTTTTCCCTCTATCCAACCAG No data
Right 1174392922 20:50228948-50228970 TGTTTATTTCTTGTTACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174392913 Original CRISPR CTGGTTGGATAGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr