ID: 1174392923

View in Genome Browser
Species Human (GRCh38)
Location 20:50228949-50228971
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174392912_1174392923 28 Left 1174392912 20:50228898-50228920 CCTGGGCCTTTTTCCCTCTATCC No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392916_1174392923 7 Left 1174392916 20:50228919-50228941 CCAACCAGCCCCACAGCACTCTG No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392915_1174392923 14 Left 1174392915 20:50228912-50228934 CCTCTATCCAACCAGCCCCACAG No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392918_1174392923 -1 Left 1174392918 20:50228927-50228949 CCCCACAGCACTCTGTCCAATTG No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392917_1174392923 3 Left 1174392917 20:50228923-50228945 CCAGCCCCACAGCACTCTGTCCA No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392914_1174392923 15 Left 1174392914 20:50228911-50228933 CCCTCTATCCAACCAGCCCCACA No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392920_1174392923 -3 Left 1174392920 20:50228929-50228951 CCACAGCACTCTGTCCAATTGTT No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392913_1174392923 22 Left 1174392913 20:50228904-50228926 CCTTTTTCCCTCTATCCAACCAG No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data
1174392919_1174392923 -2 Left 1174392919 20:50228928-50228950 CCCACAGCACTCTGTCCAATTGT No data
Right 1174392923 20:50228949-50228971 GTTTATTTCTTGTTACTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174392923 Original CRISPR GTTTATTTCTTGTTACTGTT GGG Intergenic
No off target data available for this crispr