ID: 1174393964

View in Genome Browser
Species Human (GRCh38)
Location 20:50234549-50234571
Sequence GCGTCCACCCCACCACCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174393964_1174393971 20 Left 1174393964 20:50234549-50234571 CCCCGTGGTGGTGGGGTGGACGC No data
Right 1174393971 20:50234592-50234614 AGGTTGCCAGTGCTTCGCAAGGG No data
1174393964_1174393972 21 Left 1174393964 20:50234549-50234571 CCCCGTGGTGGTGGGGTGGACGC No data
Right 1174393972 20:50234593-50234615 GGTTGCCAGTGCTTCGCAAGGGG No data
1174393964_1174393967 0 Left 1174393964 20:50234549-50234571 CCCCGTGGTGGTGGGGTGGACGC No data
Right 1174393967 20:50234572-50234594 AGTGATCCTTATCTCCGCTGAGG No data
1174393964_1174393970 19 Left 1174393964 20:50234549-50234571 CCCCGTGGTGGTGGGGTGGACGC No data
Right 1174393970 20:50234591-50234613 GAGGTTGCCAGTGCTTCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174393964 Original CRISPR GCGTCCACCCCACCACCACG GGG (reversed) Intergenic
No off target data available for this crispr