ID: 1174394356

View in Genome Browser
Species Human (GRCh38)
Location 20:50237534-50237556
Sequence GCGGTTCAGTTTCCCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174394356_1174394372 23 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG No data
1174394356_1174394370 19 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394370 20:50237576-50237598 AGGCCTGTGGGTATGGATGGTGG No data
1174394356_1174394361 -1 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394361 20:50237556-50237578 CAGGGGCCAGCATGACCCCAAGG No data
1174394356_1174394373 28 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394373 20:50237585-50237607 GGTATGGATGGTGGCTGGACTGG No data
1174394356_1174394365 12 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394365 20:50237569-50237591 GACCCCAAGGCCTGTGGGTATGG No data
1174394356_1174394369 16 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394369 20:50237573-50237595 CCAAGGCCTGTGGGTATGGATGG No data
1174394356_1174394363 6 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394363 20:50237563-50237585 CAGCATGACCCCAAGGCCTGTGG No data
1174394356_1174394364 7 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394364 20:50237564-50237586 AGCATGACCCCAAGGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174394356 Original CRISPR GCGGTTCAGTTTCCCCTTCT TGG (reversed) Intergenic
No off target data available for this crispr