ID: 1174394362

View in Genome Browser
Species Human (GRCh38)
Location 20:50237562-50237584
Sequence CACAGGCCTTGGGGTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174394362_1174394380 25 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394380 20:50237610-50237632 GGATGGGTATGGATGGTGGCTGG No data
1174394362_1174394377 14 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394377 20:50237599-50237621 CTGGACTGGTTGGATGGGTATGG No data
1174394362_1174394370 -9 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394370 20:50237576-50237598 AGGCCTGTGGGTATGGATGGTGG No data
1174394362_1174394381 30 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394381 20:50237615-50237637 GGTATGGATGGTGGCTGGACTGG No data
1174394362_1174394374 4 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394374 20:50237589-50237611 TGGATGGTGGCTGGACTGGTTGG No data
1174394362_1174394379 21 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394379 20:50237606-50237628 GGTTGGATGGGTATGGATGGTGG No data
1174394362_1174394375 8 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394375 20:50237593-50237615 TGGTGGCTGGACTGGTTGGATGG No data
1174394362_1174394372 -5 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG No data
1174394362_1174394378 18 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394378 20:50237603-50237625 ACTGGTTGGATGGGTATGGATGG No data
1174394362_1174394376 9 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394376 20:50237594-50237616 GGTGGCTGGACTGGTTGGATGGG No data
1174394362_1174394373 0 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394373 20:50237585-50237607 GGTATGGATGGTGGCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174394362 Original CRISPR CACAGGCCTTGGGGTCATGC TGG (reversed) Intergenic
No off target data available for this crispr