ID: 1174394372

View in Genome Browser
Species Human (GRCh38)
Location 20:50237580-50237602
Sequence CTGTGGGTATGGATGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174394360_1174394372 4 Left 1174394360 20:50237553-50237575 CCGCAGGGGCCAGCATGACCCCA No data
Right 1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG No data
1174394362_1174394372 -5 Left 1174394362 20:50237562-50237584 CCAGCATGACCCCAAGGCCTGTG No data
Right 1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG No data
1174394356_1174394372 23 Left 1174394356 20:50237534-50237556 CCAAGAAGGGGAAACTGAACCGC No data
Right 1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174394372 Original CRISPR CTGTGGGTATGGATGGTGGC TGG Intergenic
No off target data available for this crispr