ID: 1174396887

View in Genome Browser
Species Human (GRCh38)
Location 20:50252174-50252196
Sequence ATGACCTAAGAGAAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174396883_1174396887 -7 Left 1174396883 20:50252158-50252180 CCTCCAAGAAGCAGGCATGACCT No data
Right 1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG No data
1174396884_1174396887 -10 Left 1174396884 20:50252161-50252183 CCAAGAAGCAGGCATGACCTAAG No data
Right 1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG No data
1174396880_1174396887 15 Left 1174396880 20:50252136-50252158 CCAGCAGGACAGCCAGGGAGGGC No data
Right 1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG No data
1174396881_1174396887 3 Left 1174396881 20:50252148-50252170 CCAGGGAGGGCCTCCAAGAAGCA No data
Right 1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174396887 Original CRISPR ATGACCTAAGAGAAGGGTGC TGG Intergenic
No off target data available for this crispr