ID: 1174399153

View in Genome Browser
Species Human (GRCh38)
Location 20:50266745-50266767
Sequence CCTTCTAGGGAGGGGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174399153_1174399165 19 Left 1174399153 20:50266745-50266767 CCACACAACCCCTCCCTAGAAGG No data
Right 1174399165 20:50266787-50266809 CATTTTGGAGATGGAAACCAAGG No data
1174399153_1174399161 -7 Left 1174399153 20:50266745-50266767 CCACACAACCCCTCCCTAGAAGG No data
Right 1174399161 20:50266761-50266783 TAGAAGGAAGGTGCCACTACTGG No data
1174399153_1174399162 4 Left 1174399153 20:50266745-50266767 CCACACAACCCCTCCCTAGAAGG No data
Right 1174399162 20:50266772-50266794 TGCCACTACTGGACACATTTTGG No data
1174399153_1174399164 10 Left 1174399153 20:50266745-50266767 CCACACAACCCCTCCCTAGAAGG No data
Right 1174399164 20:50266778-50266800 TACTGGACACATTTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174399153 Original CRISPR CCTTCTAGGGAGGGGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr