ID: 1174399974

View in Genome Browser
Species Human (GRCh38)
Location 20:50270699-50270721
Sequence CGGAATCCCCAAGGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174399974_1174399983 9 Left 1174399974 20:50270699-50270721 CCAACTTCCCCTTGGGGATTCCG No data
Right 1174399983 20:50270731-50270753 CGTGGCCCCTCCAACCGAGGCGG No data
1174399974_1174399982 6 Left 1174399974 20:50270699-50270721 CCAACTTCCCCTTGGGGATTCCG No data
Right 1174399982 20:50270728-50270750 GGACGTGGCCCCTCCAACCGAGG No data
1174399974_1174399980 -9 Left 1174399974 20:50270699-50270721 CCAACTTCCCCTTGGGGATTCCG No data
Right 1174399980 20:50270713-50270735 GGGATTCCGCAGGAAGGACGTGG No data
1174399974_1174399987 17 Left 1174399974 20:50270699-50270721 CCAACTTCCCCTTGGGGATTCCG No data
Right 1174399987 20:50270739-50270761 CTCCAACCGAGGCGGATGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174399974 Original CRISPR CGGAATCCCCAAGGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr