ID: 1174400111

View in Genome Browser
Species Human (GRCh38)
Location 20:50271380-50271402
Sequence AATGTTGAAGAATGAACGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174400111_1174400115 29 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400115 20:50271432-50271454 ATGAAGCACCCACTGAGCTGGGG No data
1174400111_1174400116 30 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400116 20:50271433-50271455 TGAAGCACCCACTGAGCTGGGGG No data
1174400111_1174400114 28 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG No data
1174400111_1174400113 27 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400113 20:50271430-50271452 CAATGAAGCACCCACTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174400111 Original CRISPR AATGTTGAAGAATGAACGAA GGG (reversed) Intergenic
No off target data available for this crispr