ID: 1174400114

View in Genome Browser
Species Human (GRCh38)
Location 20:50271431-50271453
Sequence AATGAAGCACCCACTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174400112_1174400114 27 Left 1174400112 20:50271381-50271403 CCTTCGTTCATTCTTCAACATTC No data
Right 1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG No data
1174400111_1174400114 28 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG No data
1174400110_1174400114 29 Left 1174400110 20:50271379-50271401 CCCCTTCGTTCATTCTTCAACAT No data
Right 1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174400114 Original CRISPR AATGAAGCACCCACTGAGCT GGG Intergenic
No off target data available for this crispr