ID: 1174400116

View in Genome Browser
Species Human (GRCh38)
Location 20:50271433-50271455
Sequence TGAAGCACCCACTGAGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174400111_1174400116 30 Left 1174400111 20:50271380-50271402 CCCTTCGTTCATTCTTCAACATT No data
Right 1174400116 20:50271433-50271455 TGAAGCACCCACTGAGCTGGGGG No data
1174400112_1174400116 29 Left 1174400112 20:50271381-50271403 CCTTCGTTCATTCTTCAACATTC No data
Right 1174400116 20:50271433-50271455 TGAAGCACCCACTGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174400116 Original CRISPR TGAAGCACCCACTGAGCTGG GGG Intergenic
No off target data available for this crispr