ID: 1174400403

View in Genome Browser
Species Human (GRCh38)
Location 20:50272907-50272929
Sequence GGGAACAGCCTGTCATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174400399_1174400403 1 Left 1174400399 20:50272883-50272905 CCACTCAGAGACTGACATATGGT No data
Right 1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG No data
1174400396_1174400403 14 Left 1174400396 20:50272870-50272892 CCAACACCGTGCACCACTCAGAG No data
Right 1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG No data
1174400397_1174400403 8 Left 1174400397 20:50272876-50272898 CCGTGCACCACTCAGAGACTGAC No data
Right 1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG No data
1174400395_1174400403 26 Left 1174400395 20:50272858-50272880 CCAGAATTCTCTCCAACACCGTG No data
Right 1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174400403 Original CRISPR GGGAACAGCCTGTCATCCCC AGG Intergenic
No off target data available for this crispr