ID: 1174401935

View in Genome Browser
Species Human (GRCh38)
Location 20:50280659-50280681
Sequence AAAGAGGTATAGACGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174401935_1174401939 14 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG No data
1174401935_1174401940 15 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401940 20:50280697-50280719 ATCTGACCCACTGCCCAGGAGGG No data
1174401935_1174401944 23 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data
1174401935_1174401941 16 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401941 20:50280698-50280720 TCTGACCCACTGCCCAGGAGGGG No data
1174401935_1174401938 11 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174401935 Original CRISPR AAAGAGGTATAGACGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr