ID: 1174401936

View in Genome Browser
Species Human (GRCh38)
Location 20:50280675-50280697
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174401936_1174401940 -1 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401940 20:50280697-50280719 ATCTGACCCACTGCCCAGGAGGG No data
1174401936_1174401947 20 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401947 20:50280718-50280740 GGGATGCAGGCAGAGACCCCTGG No data
1174401936_1174401948 25 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401948 20:50280723-50280745 GCAGGCAGAGACCCCTGGCTTGG No data
1174401936_1174401939 -2 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG No data
1174401936_1174401944 7 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data
1174401936_1174401941 0 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401941 20:50280698-50280720 TCTGACCCACTGCCCAGGAGGGG No data
1174401936_1174401938 -5 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data
1174401936_1174401949 26 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401949 20:50280724-50280746 CAGGCAGAGACCCCTGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174401936 Original CRISPR TACACAAGGAAGAGAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr