ID: 1174401938

View in Genome Browser
Species Human (GRCh38)
Location 20:50280693-50280715
Sequence GTGTATCTGACCCACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174401935_1174401938 11 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data
1174401933_1174401938 28 Left 1174401933 20:50280642-50280664 CCTTGTATTTCTCAGTCCCTGTC No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data
1174401934_1174401938 12 Left 1174401934 20:50280658-50280680 CCCTGTCTTCGTCTATACCTCTT No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data
1174401936_1174401938 -5 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401938 20:50280693-50280715 GTGTATCTGACCCACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174401938 Original CRISPR GTGTATCTGACCCACTGCCC AGG Intergenic
No off target data available for this crispr