ID: 1174401939

View in Genome Browser
Species Human (GRCh38)
Location 20:50280696-50280718
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174401934_1174401939 15 Left 1174401934 20:50280658-50280680 CCCTGTCTTCGTCTATACCTCTT No data
Right 1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG No data
1174401936_1174401939 -2 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG No data
1174401935_1174401939 14 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401939 20:50280696-50280718 TATCTGACCCACTGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174401939 Original CRISPR TATCTGACCCACTGCCCAGG AGG Intergenic