ID: 1174401944

View in Genome Browser
Species Human (GRCh38)
Location 20:50280705-50280727
Sequence CACTGCCCAGGAGGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174401936_1174401944 7 Left 1174401936 20:50280675-50280697 CCTCTTTCTCTCTTCCTTGTGTA No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data
1174401934_1174401944 24 Left 1174401934 20:50280658-50280680 CCCTGTCTTCGTCTATACCTCTT No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data
1174401935_1174401944 23 Left 1174401935 20:50280659-50280681 CCTGTCTTCGTCTATACCTCTTT No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data
1174401937_1174401944 -7 Left 1174401937 20:50280689-50280711 CCTTGTGTATCTGACCCACTGCC No data
Right 1174401944 20:50280705-50280727 CACTGCCCAGGAGGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174401944 Original CRISPR CACTGCCCAGGAGGGGATGC AGG Intergenic
No off target data available for this crispr