ID: 1174402188

View in Genome Browser
Species Human (GRCh38)
Location 20:50282125-50282147
Sequence CCTCCTCCCTGCTGACCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174402178_1174402188 -5 Left 1174402178 20:50282107-50282129 CCCCAAGCTCCTCCCCAGCCTCC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402171_1174402188 21 Left 1174402171 20:50282081-50282103 CCTGGCCCTCAAAACACCCAGGT No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402177_1174402188 -4 Left 1174402177 20:50282106-50282128 CCCCCAAGCTCCTCCCCAGCCTC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402172_1174402188 16 Left 1174402172 20:50282086-50282108 CCCTCAAAACACCCAGGTTCCCC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402179_1174402188 -6 Left 1174402179 20:50282108-50282130 CCCAAGCTCCTCCCCAGCCTCCT No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402173_1174402188 15 Left 1174402173 20:50282087-50282109 CCTCAAAACACCCAGGTTCCCCC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402174_1174402188 5 Left 1174402174 20:50282097-50282119 CCCAGGTTCCCCCCAAGCTCCTC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402180_1174402188 -7 Left 1174402180 20:50282109-50282131 CCAAGCTCCTCCCCAGCCTCCTC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402175_1174402188 4 Left 1174402175 20:50282098-50282120 CCAGGTTCCCCCCAAGCTCCTCC No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data
1174402176_1174402188 -3 Left 1174402176 20:50282105-50282127 CCCCCCAAGCTCCTCCCCAGCCT No data
Right 1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174402188 Original CRISPR CCTCCTCCCTGCTGACCTTG GGG Intergenic
No off target data available for this crispr