ID: 1174403130

View in Genome Browser
Species Human (GRCh38)
Location 20:50286703-50286725
Sequence GCAGCCCTCAGCCCCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174403130_1174403132 -8 Left 1174403130 20:50286703-50286725 CCAGCCAGGGGGCTGAGGGCTGC No data
Right 1174403132 20:50286718-50286740 AGGGCTGCTCCTCCAAAGCTTGG No data
1174403130_1174403137 11 Left 1174403130 20:50286703-50286725 CCAGCCAGGGGGCTGAGGGCTGC No data
Right 1174403137 20:50286737-50286759 TTGGGTATGGACATGTGACCAGG No data
1174403130_1174403138 12 Left 1174403130 20:50286703-50286725 CCAGCCAGGGGGCTGAGGGCTGC No data
Right 1174403138 20:50286738-50286760 TGGGTATGGACATGTGACCAGGG No data
1174403130_1174403133 -7 Left 1174403130 20:50286703-50286725 CCAGCCAGGGGGCTGAGGGCTGC No data
Right 1174403133 20:50286719-50286741 GGGCTGCTCCTCCAAAGCTTGGG No data
1174403130_1174403134 -2 Left 1174403130 20:50286703-50286725 CCAGCCAGGGGGCTGAGGGCTGC No data
Right 1174403134 20:50286724-50286746 GCTCCTCCAAAGCTTGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174403130 Original CRISPR GCAGCCCTCAGCCCCCTGGC TGG (reversed) Intergenic
No off target data available for this crispr