ID: 1174404975

View in Genome Browser
Species Human (GRCh38)
Location 20:50296983-50297005
Sequence CCCCCAAGACGGGGGTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174404965_1174404975 -7 Left 1174404965 20:50296967-50296989 CCAGACAGGGCCCTGGCCCCCAA No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404957_1174404975 16 Left 1174404957 20:50296944-50296966 CCCCAGGGCACCGGCCTTTATAT No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404959_1174404975 14 Left 1174404959 20:50296946-50296968 CCAGGGCACCGGCCTTTATATCC No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404963_1174404975 2 Left 1174404963 20:50296958-50296980 CCTTTATATCCAGACAGGGCCCT No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404955_1174404975 25 Left 1174404955 20:50296935-50296957 CCGGCTGCACCCCAGGGCACCGG No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404961_1174404975 6 Left 1174404961 20:50296954-50296976 CCGGCCTTTATATCCAGACAGGG No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data
1174404958_1174404975 15 Left 1174404958 20:50296945-50296967 CCCAGGGCACCGGCCTTTATATC No data
Right 1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174404975 Original CRISPR CCCCCAAGACGGGGGTGGAC GGG Intergenic
No off target data available for this crispr