ID: 1174405176

View in Genome Browser
Species Human (GRCh38)
Location 20:50298284-50298306
Sequence AAAAGACACAAGGACACCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174405176_1174405178 -4 Left 1174405176 20:50298284-50298306 CCAAGGGTGTCCTTGTGTCTTTT 0: 1
1: 0
2: 2
3: 17
4: 263
Right 1174405178 20:50298303-50298325 TTTTTGTCATTCATCCCTCCCGG 0: 1
1: 1
2: 3
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174405176 Original CRISPR AAAAGACACAAGGACACCCT TGG (reversed) Intergenic
906057299 1:42927244-42927266 GAAAGACACACAGACACACTTGG + Intronic
907739086 1:57146378-57146400 AACAGACAGAAGGACACTCCAGG - Intronic
908659389 1:66420975-66420997 AAAAGGCAGAAGGAAACCATCGG - Intergenic
909070054 1:70983252-70983274 AAAAAACTCAAGCACATCCTGGG - Intronic
909359241 1:74742588-74742610 AAAAGGCAGAAGGAAACCGTTGG - Intronic
909897646 1:81093333-81093355 AAGAGACACAAGGAGACTTTTGG + Intergenic
911556132 1:99347198-99347220 GAAAGACAAAAGCACTCCCTTGG + Intergenic
911720337 1:101183878-101183900 AAAAGATACAATGAAACCTTTGG - Intergenic
912946427 1:114088554-114088576 AACAGACACAATGACCCCTTTGG + Intergenic
914841517 1:151252892-151252914 AAAAGAGACAAGGTCTCACTGGG - Intergenic
915048461 1:153040802-153040824 AAAAGACACCAGGAAAACATGGG + Intronic
915305060 1:154972530-154972552 AAAACACACAAACACACACTAGG + Intronic
916132836 1:161626405-161626427 GAAAGACACAGAGACACCCCAGG + Intronic
916636032 1:166669656-166669678 TAAAGAAACAAAGACAGCCTTGG - Intergenic
917280315 1:173373273-173373295 AAAAGGCAGAAGGAAACCATCGG + Intergenic
918937941 1:190948660-190948682 CTAAGACACAAGCACACACTAGG - Intergenic
920918631 1:210279277-210279299 CAAAGACACAAGGCCCCCTTGGG - Intergenic
921220734 1:212971984-212972006 AAAACACACAAGAACCCCCATGG - Intronic
922884062 1:229004567-229004589 AATAGACATCGGGACACCCTTGG + Intergenic
923047862 1:230368684-230368706 AAAAGACACAGGGACAGGGTCGG + Intronic
923407195 1:233673794-233673816 CAAAGACAAAAAGAAACCCTGGG - Intergenic
924138801 1:241000303-241000325 AAAAGGCACAAGGAAACTTTTGG + Intronic
924787649 1:247213465-247213487 AACAGAAACTAGGACACCTTGGG - Intergenic
1063700412 10:8378970-8378992 AAAAGACAGAGGGACAGGCTGGG - Intergenic
1063783998 10:9359489-9359511 AAAAGAAACAAGGAGAGGCTAGG + Intergenic
1064107029 10:12508891-12508913 ATAAGCCACAAGGACACTCCTGG + Intronic
1064866687 10:19888634-19888656 AACAGAGACAAGGACAACATTGG + Intronic
1066310174 10:34188469-34188491 ACAAAACACAAAGACAACCTGGG + Intronic
1067525068 10:47033623-47033645 ACATGATACAAGGACAGCCTTGG + Intergenic
1068017327 10:51533709-51533731 TAAAGATACATGGATACCCTTGG - Intronic
1070153642 10:73820145-73820167 AAAAGACAGAGGAACACTCTAGG - Intronic
1071399208 10:85253101-85253123 AAAAGACAGAAGGACAGGCTAGG + Intergenic
1071710093 10:88041557-88041579 AAAAAACACAAGGGCACCTCAGG - Intergenic
1072416604 10:95251877-95251899 CAAGGAAACAAGAACACCCTGGG - Intronic
1073686727 10:105762846-105762868 AAAAGACACAAGCTCACTTTTGG + Intergenic
1074147895 10:110732858-110732880 AACAGACCCCAGGAAACCCTAGG + Intronic
1075252396 10:120891919-120891941 AAACGACACAAGGACAGACATGG - Intronic
1075738584 10:124679422-124679444 TAAATACACAGGGATACCCTAGG + Intronic
1076115347 10:127892360-127892382 AATAGACACAAGGAGAACCGAGG + Intronic
1076140975 10:128078280-128078302 CAAAGGCAGAGGGACACCCTGGG + Intronic
1076596943 10:131629261-131629283 TAAACACACAAGCACACCCTGGG + Intergenic
1076747309 10:132520949-132520971 AAAAGACACATGAAGCCCCTGGG + Intergenic
1078731501 11:13979262-13979284 AAAAGACACAGAGACACACAGGG - Intronic
1079323083 11:19468481-19468503 AGAAGACACAGAGACACCCAGGG - Intronic
1079727925 11:23899263-23899285 AAAAAATACAAGGAAAGCCTTGG + Intergenic
1080385416 11:31808017-31808039 AAAAGATACAACGGCACCGTGGG + Intronic
1080729309 11:34932771-34932793 AATAGACACAAACACACACTAGG + Intronic
1084204030 11:67580888-67580910 AAAAAAAAAAAGGACAGCCTGGG + Intergenic
1086161576 11:83727578-83727600 AAAAGTCACAAAGAAATCCTGGG - Intronic
1087511228 11:99097170-99097192 AAAAGACACAAGGTGACATTTGG - Intronic
1089246360 11:117123422-117123444 AAAATACACAAAGCCTCCCTGGG - Intergenic
1089319154 11:117613277-117613299 AAAAGACACAAGGGTGCTCTTGG + Intronic
1089718463 11:120388050-120388072 AAAATGCACAAGGAAACCTTTGG - Intronic
1089822884 11:121244894-121244916 GAAGGGCATAAGGACACCCTTGG - Intergenic
1089897065 11:121941352-121941374 AAAAGAAACAAGGGAAACCTAGG - Intergenic
1090450981 11:126806107-126806129 AAAAGACACAAAGAGAGGCTGGG + Intronic
1091028672 11:132163878-132163900 AAAAAAAACAAAGACACCATGGG - Intronic
1092269533 12:7012275-7012297 AAAAGAGAAAAGGACACCAAGGG + Intronic
1096108129 12:49010759-49010781 AAAAGACACAAACACACCATAGG - Intronic
1096191231 12:49621686-49621708 AAAAAACAGAAGGTCTCCCTGGG + Intronic
1096850203 12:54430637-54430659 AAAGCACACAGGGACTCCCTGGG + Intergenic
1096858573 12:54505426-54505448 AAAAGGCACAAGGAACCCTTGGG - Intronic
1097028975 12:56078521-56078543 AAAAGAGAGAAAGAAACCCTAGG + Intergenic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1102298585 12:111755619-111755641 AAAAGACCCGAGGGCAGCCTGGG - Intronic
1102464016 12:113117502-113117524 AAAAGGCATAAGGACAGCCCTGG + Intronic
1102611851 12:114119333-114119355 AGCACCCACAAGGACACCCTAGG + Intergenic
1102791829 12:115652874-115652896 AAGGGATACAAGGACACCATTGG - Intergenic
1103905049 12:124322853-124322875 AAAACACACCAGGACATCCCCGG + Intergenic
1107559071 13:41544334-41544356 GAAAGAGAAAAGGACACCCAAGG - Intergenic
1108757066 13:53516354-53516376 AAAAGACACAATGCAACCTTAGG - Intergenic
1108793425 13:54001152-54001174 AAAAGACTCCATGCCACCCTTGG + Intergenic
1109961716 13:69639686-69639708 GAATGACACAAGCACTCCCTTGG + Intergenic
1110978380 13:81867745-81867767 GAAAGACTCAAGGACACCTGGGG - Intergenic
1111223965 13:85245013-85245035 AAAAGACACAAGAAAACTTTGGG + Intergenic
1111625910 13:90786395-90786417 AAAAGAGACAAGAACACTATAGG - Intergenic
1112009516 13:95282273-95282295 TAGAGAAACAAGGACTCCCTGGG + Intronic
1112381641 13:98896497-98896519 AAAAAAAACAAGGATACCTTTGG + Intronic
1112396505 13:99037964-99037986 AAAAGGCACAAGGAGACTTTGGG + Intronic
1113347110 13:109489705-109489727 ACATGACACAAGGACCCCCAGGG - Intergenic
1113573151 13:111373060-111373082 AAAATACATAAAGACACCGTGGG - Intergenic
1115093216 14:29603595-29603617 AAAAGTCACATGGACCACCTTGG - Intronic
1115185402 14:30683013-30683035 AGACGACACAAGGACAGGCTGGG + Intronic
1116019782 14:39446257-39446279 AAAAGACTAAAGAACACCATGGG - Intergenic
1116251848 14:42495413-42495435 AAAAGACACAAGGAAACTGGAGG - Intergenic
1116471627 14:45292365-45292387 AACAGACACAAGGAAACTTTAGG + Intergenic
1117246249 14:53889585-53889607 AAAGGATACAAGGACATTCTGGG - Intergenic
1117895539 14:60481873-60481895 AAAAGACAAAAGGATAAGCTAGG - Intronic
1118006996 14:61572276-61572298 AAAAGAAACAAGGACAGCTTGGG + Intronic
1118070244 14:62238796-62238818 AGAAGACACAAGTACAACCAGGG + Intergenic
1118999705 14:70871150-70871172 AAAAGGCACATTGACACCCATGG - Intergenic
1119842415 14:77803170-77803192 AAAAGACCCAAAAATACCCTTGG - Intronic
1119856096 14:77902068-77902090 AAAAGCCAAAAGGACACCTTAGG - Intronic
1120698287 14:87668954-87668976 AAAACAAATAAGGACACGCTAGG - Intergenic
1122255513 14:100472950-100472972 AAAAGACACTGGGACACCCAGGG - Intronic
1122572986 14:102720673-102720695 AAAAGACAGAAGAAATCCCTGGG - Intronic
1123131688 14:105991788-105991810 AAAACAGCCAGGGACACCCTGGG - Intergenic
1124528213 15:30477583-30477605 GGAAGACAAAAGGACACTCTGGG - Intergenic
1124770444 15:32530120-32530142 GGAAGACAAAAGGACACTCTGGG + Intergenic
1124832277 15:33160777-33160799 AGAAGACACGAAGACTCCCTGGG - Intronic
1124914733 15:33958844-33958866 AAAAGACACGAGCACACCTATGG - Intronic
1125061198 15:35427027-35427049 AAAAGACAAAAGGAAACACAAGG + Intronic
1125136570 15:36350661-36350683 AAAAGACAAAAGGACAAAGTAGG - Intergenic
1126332437 15:47548024-47548046 AAAAGACACAGGGATACCATTGG - Intronic
1126366484 15:47899830-47899852 AAAAGAGACAAGGCCAGGCTTGG - Intergenic
1127020289 15:54738901-54738923 AAACTACCCAATGACACCCTAGG + Intergenic
1127666716 15:61154814-61154836 AAAATACACACTGACACCGTCGG + Intronic
1128371358 15:67041839-67041861 AAAAAAAAAAAGGACAGCCTGGG - Intergenic
1128630107 15:69256315-69256337 AAAAGACATAAACACACCATCGG - Exonic
1129255037 15:74329661-74329683 AGAGGACCCAAGGTCACCCTGGG - Intronic
1130075504 15:80685794-80685816 AGAAGACAAAAGCACATCCTTGG + Intronic
1130318354 15:82816488-82816510 GTAAGACAAAAGGACACTCTGGG - Intronic
1131248346 15:90814980-90815002 AAAATGCACAAGGACACATTAGG + Intronic
1131433033 15:92401702-92401724 AAAAGGCACTGGGAAACCCTTGG - Intronic
1134337520 16:13314701-13314723 AAAGGACACAAGGAAACTTTTGG - Intergenic
1136350032 16:29700857-29700879 AAAAGTCACAGGGGTACCCTGGG - Intergenic
1136872710 16:33823311-33823333 AAAACAGACATGGACACCCATGG + Intergenic
1140877058 16:79162548-79162570 TGAAGACACAGGGATACCCTTGG + Intronic
1141645374 16:85364664-85364686 AACAGACACAGGAACACCCCTGG + Intergenic
1141890053 16:86920263-86920285 GAAAGACAAAAGGGCCCCCTGGG - Intergenic
1203099463 16_KI270728v1_random:1292743-1292765 AAAACAGACATGGACACCCATGG - Intergenic
1142711764 17:1727391-1727413 CAAAGACACAGGGACCTCCTTGG - Exonic
1143893461 17:10119528-10119550 ACAAGAATCAAGGACACTCTTGG - Intronic
1145289859 17:21534527-21534549 AGAAGCCACAAGGACAGCCAAGG + Exonic
1147046406 17:37755470-37755492 CCATGGCACAAGGACACCCTTGG - Intergenic
1147542342 17:41370933-41370955 AAAAAAAAAAAGGAAACCCTTGG + Intronic
1149322862 17:55499118-55499140 AAAAGACACCAGGACAGAGTTGG - Intergenic
1151258480 17:72898251-72898273 CAAAGACATAAGGATACACTGGG + Intronic
1152451138 17:80381044-80381066 TCAAGACAAAAGGACTCCCTGGG - Intronic
1152876707 17:82790488-82790510 CAAAGACACCAGGACACACGGGG - Intronic
1153600631 18:6777875-6777897 AAAACACCCAAGAACACCATTGG + Intronic
1153894020 18:9542994-9543016 AAAAGACACATTCACTCCCTAGG + Intergenic
1156210481 18:34935022-34935044 AAAAGATACAAGGACATGCTGGG - Intergenic
1156693725 18:39740434-39740456 AAAAGAGACACAGACACACTGGG - Intergenic
1156792598 18:40994033-40994055 AAAAAACACATGGACAGTCTAGG - Intergenic
1157686768 18:49649066-49649088 AAAAGAAGCACTGACACCCTGGG + Intergenic
1157726404 18:49967710-49967732 AAATCTCACAAGGCCACCCTGGG + Intronic
1159230520 18:65602096-65602118 AAAGGAAGCAAGGACACCCTTGG - Intergenic
1163624792 19:18382962-18382984 AAGAGACACAAGGACTCACTAGG - Intronic
1167435331 19:49475567-49475589 AAGAGGCAGAAGGACACCCAGGG + Intronic
925168690 2:1737169-1737191 ACAAGACACCAGAACACCCAAGG + Intronic
925873935 2:8295899-8295921 AAAACACACAGGGACCGCCTTGG + Intergenic
926381199 2:12291795-12291817 AAAAGACATGAGAACAGCCTGGG + Intergenic
926512390 2:13798576-13798598 AAATGACACAAGGACCCCTGTGG + Intergenic
929339448 2:40796272-40796294 GAAAGACACAAGTAAACTCTTGG - Intergenic
931239762 2:60441634-60441656 TATAGACACAAGGACCCCCTAGG + Intergenic
932566172 2:72911571-72911593 AAAAAAAACAAAAACACCCTGGG + Intergenic
935081602 2:99802683-99802705 AAAAAAAAAAAAGACACCCTAGG - Intronic
937996794 2:127700527-127700549 AAAGGACACAGGGCCACCCAGGG + Intergenic
939852280 2:147316771-147316793 AAAAGGCAGAAGGAAACCGTCGG + Intergenic
943606627 2:189984264-189984286 ATAAGACACAGGTACACCCTGGG + Intronic
945576935 2:211542913-211542935 AAAAGGGAAAAGTACACCCTAGG + Intronic
945839554 2:214871214-214871236 AAAAAAAACTAGGACACACTTGG + Intergenic
946336953 2:219044146-219044168 AAAAGACAAAAGGAGACACCAGG + Intergenic
946725436 2:222657023-222657045 CAAAGAGACAAGCACACACTGGG + Intergenic
947697404 2:232203393-232203415 AAGACAGAAAAGGACACCCTTGG + Intronic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
1169101160 20:2950918-2950940 AAAAGACACAAGAAAACTTTGGG - Intronic
1169531737 20:6492352-6492374 AACAGATGCAAGGACAGCCTCGG - Intergenic
1170716453 20:18835580-18835602 AAAAGACACTAGGTCAGCATTGG + Intergenic
1171055573 20:21903290-21903312 GAAAGACCCATGTACACCCTAGG - Intergenic
1172511048 20:35501348-35501370 AAAAGAGAAGAGGACACCTTGGG + Intronic
1173789214 20:45816777-45816799 AGACGACACAAGGACAGGCTGGG - Exonic
1174405176 20:50298284-50298306 AAAAGACACAAGGACACCCTTGG - Intergenic
1174710790 20:52702934-52702956 AAAAGAAACAAGGACATTCTCGG - Intergenic
1175062246 20:56254308-56254330 CCAACACACAAGGACACCCAAGG + Intergenic
1176296742 21:5077005-5077027 AAAAGACACAAAGTCCCCCATGG + Intergenic
1179242745 21:39606582-39606604 AACAGATACAAAGAGACCCTGGG + Intronic
1179860307 21:44185116-44185138 AAAAGACACAAAGTCCCCCATGG - Intergenic
1180242238 21:46517563-46517585 AAGAGACACATGGACACACCAGG - Intronic
1181085728 22:20438513-20438535 TAAAGACAGAAGGAGACCCCCGG + Intronic
1182294643 22:29305950-29305972 AAAGGTCACAAGGACTCTCTGGG + Intergenic
1182899591 22:33886845-33886867 AAACGACAAAAAGACACCCCTGG + Intronic
1183843456 22:40520065-40520087 AAGGGACACAAGAAAACCCTAGG - Intronic
1184969380 22:48004303-48004325 AAAATACACACGGAGAGCCTGGG - Intergenic
949720660 3:6986240-6986262 AACGGACACAAGGAAACCTTTGG + Intronic
950988788 3:17408324-17408346 AAAAGAGACAAGGTCTCACTTGG + Intronic
951295744 3:20932377-20932399 AAAATACACGAAGACACTCTGGG + Intergenic
952455172 3:33465922-33465944 AAAAGCCACATTGACACCCATGG - Intergenic
952504032 3:33991186-33991208 AAAAGTCTCAGGGACCCCCTAGG - Intergenic
954076146 3:48182547-48182569 CAAAGAGGCAAGGACAGCCTGGG + Intronic
954587410 3:51747711-51747733 AAAAGGCAGAAGGAAACCGTTGG + Intergenic
955006793 3:54976159-54976181 AAAAGACAGCAGGACACAGTAGG - Intronic
956210960 3:66800858-66800880 CTAAGACACAAACACACCCTAGG - Intergenic
957462723 3:80542589-80542611 GAAAGACACAAGAAGACACTAGG - Intergenic
959651804 3:108757605-108757627 AAAAGGCAGGAGGACTCCCTTGG - Intergenic
960028967 3:113038900-113038922 AAAAGTCATAAGGGCAACCTAGG + Intergenic
961559825 3:127720950-127720972 AAAAGACCAAAGGCCATCCTTGG - Intronic
963355221 3:144202796-144202818 ACAGGACACAAGGACACAATTGG - Intergenic
964203981 3:154150126-154150148 AAAAAAAAAAAGGACATCCTTGG - Intronic
964219640 3:154328599-154328621 AAAAAAGACAAGGACATCTTTGG - Intergenic
965641709 3:170835885-170835907 AAAAGAAAAAAGGAAAGCCTAGG + Intronic
965864471 3:173188967-173188989 AAAAGGCAAAAGGAAACCTTTGG - Intergenic
967360937 3:188631000-188631022 AATAGACACTAGGACATACTTGG + Intronic
968381445 4:100226-100248 AAAAGCCACATTGACACCCATGG + Intergenic
968590788 4:1458766-1458788 AACAGCCACAGGGACTCCCTGGG - Intergenic
974065472 4:57073142-57073164 AGACGACACAAGGACAGGCTGGG - Intronic
974685117 4:65217220-65217242 AAAAGTCACATGGACAGCATGGG + Intergenic
974807922 4:66905218-66905240 AAAAGACATTAGTACACACTAGG - Intergenic
975353870 4:73376509-73376531 AAAAGAAAAAAAGACACTCTAGG + Intergenic
976403398 4:84634635-84634657 CAAAGACACAACCACACCCTTGG - Intronic
977399250 4:96510512-96510534 AAGTGACACAAGCACACCCATGG - Intergenic
978151061 4:105435558-105435580 AAAGGACACAAGAACACCAGTGG - Intronic
978652122 4:111018457-111018479 AAAATAAACACGGACACTCTTGG + Intergenic
980049695 4:128026623-128026645 AAAAGAAAAAATGACAGCCTGGG - Intronic
980290484 4:130843825-130843847 AAAAGGCAGAAGGAAACCGTTGG - Intergenic
982774731 4:159430066-159430088 AAAGGACACAAGGAAACTTTCGG - Intergenic
983005562 4:162480356-162480378 AAAAGATATAAGAAAACCCTGGG - Intergenic
983172648 4:164553223-164553245 AAAAGAGACAATGCCATCCTAGG - Intergenic
985187875 4:187337247-187337269 AACAGAGACACAGACACCCTGGG - Intergenic
985801077 5:2005583-2005605 AGAAGACGCAAGGGCCCCCTGGG + Intergenic
985840764 5:2303537-2303559 AAAAGACACAGGGAAACCCATGG - Intergenic
986483608 5:8213682-8213704 AAAAGACACAATGACAACTGAGG + Intergenic
989630396 5:43476299-43476321 AAAAGACAAACTGAAACCCTTGG - Intronic
990419288 5:55615816-55615838 AAAAGGCAGAAGGAAACCATCGG + Intergenic
992204695 5:74420098-74420120 AAAAGACACAAGGAAAAAATTGG - Intergenic
992471330 5:77058071-77058093 AAGAGAGACAAGGACACTTTTGG + Intronic
993004678 5:82417565-82417587 CCTAGACACATGGACACCCTAGG - Intergenic
993164039 5:84328558-84328580 AATATATATAAGGACACCCTAGG - Intronic
999632293 5:153583527-153583549 AAAAGACACACAGACACACGAGG - Intronic
1000427321 5:161107059-161107081 AAAAGAAACAAAGTCAGCCTAGG + Intergenic
1000657964 5:163904808-163904830 AAAAGCCACAAGGAATGCCTGGG + Intergenic
1001650568 5:173312940-173312962 AAAAGTCACAAAGCCAACCTAGG - Intergenic
1003334012 6:5153612-5153634 GAAATACACACGGACACTCTTGG + Intronic
1004697658 6:18048750-18048772 AAAAAATACAAGGACACCAAAGG + Intergenic
1006000723 6:30963024-30963046 AAGAGACACAAGGAGATACTAGG - Intergenic
1007030450 6:38621802-38621824 AAAAGGCAGAAGGAAACCGTCGG + Intronic
1007067698 6:39008553-39008575 AAGAGACCCAAAAACACCCTTGG - Intronic
1009950866 6:70394206-70394228 CAAAGGCACAAGGACAGGCTGGG + Intergenic
1010163899 6:72892963-72892985 AATAGACATATGGACATCCTGGG + Intronic
1011203609 6:84866796-84866818 AAAAGTCACAAGGACATGTTAGG - Intergenic
1013277660 6:108601269-108601291 AAAAAGCACTAGGACACCTTGGG - Intronic
1016085173 6:139904586-139904608 AATTGAAACTAGGACACCCTAGG + Intergenic
1017951446 6:159138314-159138336 AATAGACACAAGGCCTGCCTCGG + Intergenic
1019587190 7:1812001-1812023 AAATGTCACCAGGACACCATGGG - Intergenic
1020632145 7:10652236-10652258 CAAAGACACAAGGTCCCCCAGGG - Intergenic
1020827234 7:13044519-13044541 AAAAGACACAGAGACACACAAGG + Intergenic
1022620214 7:31975960-31975982 AAAAGAGACAAAGATACCATGGG - Intronic
1023600749 7:41879596-41879618 AAAAGATATAAGGAGACTCTGGG - Intergenic
1024314972 7:48007501-48007523 AAAAAAAACAAGGACATCCAGGG + Intronic
1026394467 7:69937349-69937371 AAAAGAGACAAGGAAATCTTTGG - Intronic
1028609200 7:92690223-92690245 AAAACCCACAAAGACAACCTAGG - Intronic
1029818686 7:103123862-103123884 AAAGGACACAAGGAAACTTTTGG + Intronic
1030971573 7:116063619-116063641 AAAAGAAAAAAGAACACCCTGGG + Intronic
1038467712 8:27780449-27780471 ACAAGAAACAAGGAGATCCTAGG + Intronic
1041020604 8:53634370-53634392 AAACTACACAAGGACCCCTTGGG + Intergenic
1041033852 8:53766677-53766699 ATAAGAGACAGGTACACCCTGGG - Intronic
1041344356 8:56880871-56880893 ACAAAACACAAGGAAACCATTGG + Intergenic
1042299077 8:67256670-67256692 AAAACACACATTGACATCCTTGG - Intronic
1042377026 8:68063419-68063441 ACAAAACACAAGGTGACCCTGGG + Intronic
1042536926 8:69868553-69868575 AAAAGTCACTAGCACATCCTAGG + Intergenic
1042772307 8:72393355-72393377 AAAAGGCAGAAGGAAACCGTTGG + Intergenic
1043994877 8:86800644-86800666 AAAAGACACAGGTACTCCCATGG - Intergenic
1044524782 8:93240196-93240218 AAGTGAAACAAGGACATCCTGGG - Intergenic
1045206560 8:100048000-100048022 AAATGAAACAAAGATACCCTTGG + Intronic
1046845682 8:118913045-118913067 AAAAGACTCAAGAAAACCCAAGG + Intergenic
1048555106 8:135468315-135468337 AAAAGAAACCAGGGCACCTTTGG - Intronic
1051901802 9:22051007-22051029 TAATGACACAAGGAAACACTTGG + Intergenic
1052563720 9:30118739-30118761 AAGAGACAGAAGGACAACTTTGG + Intergenic
1055134635 9:72813990-72814012 AAAAGCATAAAGGACACCCTAGG - Intronic
1056513284 9:87326621-87326643 AAAAGGCACAATGACCCCTTGGG + Intergenic
1057501258 9:95598240-95598262 AGAAGGCTGAAGGACACCCTTGG + Intergenic
1057633984 9:96746056-96746078 GAAATAGACAAGGACACACTAGG + Intergenic
1057818318 9:98311947-98311969 ACAAGACAAAAAGACACCCAGGG + Intronic
1058807890 9:108610029-108610051 AGAAGACTCAAAGACACCCCAGG + Intergenic
1059897461 9:118883040-118883062 AGAAAACAAAAAGACACCCTGGG - Intergenic
1189142767 X:38624019-38624041 AACAGACCCAAGGTCACACTTGG + Intronic
1189358351 X:40328432-40328454 AAAAGAAACAAGGACACTCTGGG + Intergenic
1190359986 X:49639659-49639681 AAAGGAGACAAGGAAACCATGGG - Intergenic
1191169064 X:57422740-57422762 GGAGGACACAAGGACACTCTGGG + Intronic
1191720102 X:64222309-64222331 AGAAGGCACATGGACACTCTGGG - Intergenic
1191964216 X:66739325-66739347 AAAAGACACAGAATCACCCTAGG - Intergenic
1193971488 X:88060446-88060468 AAAAGAACCAAGGACATTCTGGG + Intergenic
1196075408 X:111570058-111570080 AAAAGCCACAAGGACTTTCTTGG + Intergenic
1196661949 X:118279310-118279332 AAAAGGCAGAAGGAAACCATTGG - Intergenic
1196891241 X:120292766-120292788 AAAAAAATCAAGGCCACCCTAGG + Intronic
1196997677 X:121401953-121401975 AGAAGAAACAAGGCCACCCAGGG - Intergenic
1197347389 X:125340822-125340844 ATAGGACACAAGGACTCCCAGGG - Intergenic
1197692256 X:129514721-129514743 AAAAGACAGAAGGACACACAGGG + Intronic
1198115422 X:133540236-133540258 AAAAGACACATGAACACGCATGG + Intronic
1199239714 X:145532066-145532088 ATAAGACTGAAAGACACCCTGGG - Intergenic
1201404141 Y:13633290-13633312 AAAAGGCAGAAGGAAACCATTGG + Intergenic
1202058443 Y:20860364-20860386 AAAAGTCACAATGTCATCCTGGG + Intergenic