ID: 1174412240

View in Genome Browser
Species Human (GRCh38)
Location 20:50343672-50343694
Sequence CCGCGGGGCGGCCTCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174412240_1174412251 23 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412251 20:50343718-50343740 CCTTGTGTCTGTGCCGACGGTGG No data
1174412240_1174412252 24 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412252 20:50343719-50343741 CTTGTGTCTGTGCCGACGGTGGG No data
1174412240_1174412247 -2 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412247 20:50343693-50343715 GGTGTGTGCCAGGCTGACAATGG No data
1174412240_1174412249 20 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412249 20:50343715-50343737 GCTCCTTGTGTCTGTGCCGACGG No data
1174412240_1174412253 29 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412253 20:50343724-50343746 GTCTGTGCCGACGGTGGGAGAGG No data
1174412240_1174412254 30 Left 1174412240 20:50343672-50343694 CCTGTGGAGAGGCCGCCCCGCGG No data
Right 1174412254 20:50343725-50343747 TCTGTGCCGACGGTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174412240 Original CRISPR CCGCGGGGCGGCCTCTCCAC AGG (reversed) Intergenic