ID: 1174414172

View in Genome Browser
Species Human (GRCh38)
Location 20:50356383-50356405
Sequence TGGGCCTCCCTGGGAAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174414159_1174414172 30 Left 1174414159 20:50356330-50356352 CCAGAAGCCGCTAGGAGGAGAAG No data
Right 1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG No data
1174414161_1174414172 23 Left 1174414161 20:50356337-50356359 CCGCTAGGAGGAGAAGGCAGTTG No data
Right 1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG No data
1174414169_1174414172 -8 Left 1174414169 20:50356368-50356390 CCTGGGGCAGGTGGATGGGCCTC No data
Right 1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174414172 Original CRISPR TGGGCCTCCCTGGGAAGATC TGG Intergenic
No off target data available for this crispr