ID: 1174417921

View in Genome Browser
Species Human (GRCh38)
Location 20:50379717-50379739
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174417921_1174417925 -6 Left 1174417921 20:50379717-50379739 CCTGTCCTTGCGATGCAGGGTTC No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG 0: 1
1: 0
2: 1
3: 27
4: 283
1174417921_1174417929 15 Left 1174417921 20:50379717-50379739 CCTGTCCTTGCGATGCAGGGTTC No data
Right 1174417929 20:50379755-50379777 GGGACACCAGCCATAGTCCCAGG No data
1174417921_1174417924 -10 Left 1174417921 20:50379717-50379739 CCTGTCCTTGCGATGCAGGGTTC No data
Right 1174417924 20:50379730-50379752 TGCAGGGTTCCCAGCAGGACAGG No data
1174417921_1174417926 -5 Left 1174417921 20:50379717-50379739 CCTGTCCTTGCGATGCAGGGTTC No data
Right 1174417926 20:50379735-50379757 GGTTCCCAGCAGGACAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174417921 Original CRISPR GAACCCTGCATCGCAAGGAC AGG (reversed) Intergenic