ID: 1174417925

View in Genome Browser
Species Human (GRCh38)
Location 20:50379734-50379756
Sequence GGGTTCCCAGCAGGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174417916_1174417925 19 Left 1174417916 20:50379692-50379714 CCTTCCTAGAAGCTTCCTCAGAA No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417918_1174417925 4 Left 1174417918 20:50379707-50379729 CCTCAGAAAACCTGTCCTTGCGA No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417912_1174417925 25 Left 1174417912 20:50379686-50379708 CCCCTCCCTTCCTAGAAGCTTCC No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417911_1174417925 30 Left 1174417911 20:50379681-50379703 CCAAACCCCTCCCTTCCTAGAAG No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417921_1174417925 -6 Left 1174417921 20:50379717-50379739 CCTGTCCTTGCGATGCAGGGTTC No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417913_1174417925 24 Left 1174417913 20:50379687-50379709 CCCTCCCTTCCTAGAAGCTTCCT No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417917_1174417925 15 Left 1174417917 20:50379696-50379718 CCTAGAAGCTTCCTCAGAAAACC No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417914_1174417925 23 Left 1174417914 20:50379688-50379710 CCTCCCTTCCTAGAAGCTTCCTC No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data
1174417915_1174417925 20 Left 1174417915 20:50379691-50379713 CCCTTCCTAGAAGCTTCCTCAGA No data
Right 1174417925 20:50379734-50379756 GGGTTCCCAGCAGGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174417925 Original CRISPR GGGTTCCCAGCAGGACAGGC AGG Intergenic