ID: 1174418442

View in Genome Browser
Species Human (GRCh38)
Location 20:50383493-50383515
Sequence GGATAAAACAAGTCTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174418442_1174418447 -5 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418447 20:50383511-50383533 TATCCCCTCAGTTTCAGGAGGGG No data
1174418442_1174418444 -10 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418444 20:50383506-50383528 TGTTTTATCCCCTCAGTTTCAGG No data
1174418442_1174418445 -7 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418445 20:50383509-50383531 TTTATCCCCTCAGTTTCAGGAGG No data
1174418442_1174418448 -4 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418448 20:50383512-50383534 ATCCCCTCAGTTTCAGGAGGGGG No data
1174418442_1174418452 11 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418452 20:50383527-50383549 GGAGGGGGTCCCTTCCTTGAAGG No data
1174418442_1174418446 -6 Left 1174418442 20:50383493-50383515 CCATCCTGAGACTTGTTTTATCC No data
Right 1174418446 20:50383510-50383532 TTATCCCCTCAGTTTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174418442 Original CRISPR GGATAAAACAAGTCTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr