ID: 1174420927

View in Genome Browser
Species Human (GRCh38)
Location 20:50398841-50398863
Sequence CCTACTATGTACCAGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174420927_1174420933 -9 Left 1174420927 20:50398841-50398863 CCCCACTCCTGGTACATAGTAGG No data
Right 1174420933 20:50398855-50398877 CATAGTAGGTCCACAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174420927 Original CRISPR CCTACTATGTACCAGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr