ID: 1174427750

View in Genome Browser
Species Human (GRCh38)
Location 20:50444806-50444828
Sequence CTGTAGCCCAGGCTGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174427750_1174427755 25 Left 1174427750 20:50444806-50444828 CCGAGCTCCAGCCTGGGCTACAG No data
Right 1174427755 20:50444854-50444876 AAAAAAAAATCAAAGAGGCCGGG No data
1174427750_1174427754 24 Left 1174427750 20:50444806-50444828 CCGAGCTCCAGCCTGGGCTACAG No data
Right 1174427754 20:50444853-50444875 AAAAAAAAAATCAAAGAGGCCGG No data
1174427750_1174427753 20 Left 1174427750 20:50444806-50444828 CCGAGCTCCAGCCTGGGCTACAG No data
Right 1174427753 20:50444849-50444871 AAAAAAAAAAAAAATCAAAGAGG 0: 14
1: 188
2: 6182
3: 41631
4: 84589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174427750 Original CRISPR CTGTAGCCCAGGCTGGAGCT CGG (reversed) Intergenic
No off target data available for this crispr