ID: 1174431816

View in Genome Browser
Species Human (GRCh38)
Location 20:50475601-50475623
Sequence CTCCCTTAATGGCACAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174431812_1174431816 -3 Left 1174431812 20:50475581-50475603 CCAAGCTGCAAAATATCTTTCTC No data
Right 1174431816 20:50475601-50475623 CTCCCTTAATGGCACAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174431816 Original CRISPR CTCCCTTAATGGCACAAATG GGG Intergenic
No off target data available for this crispr