ID: 1174439584

View in Genome Browser
Species Human (GRCh38)
Location 20:50539743-50539765
Sequence CTCCTGGGCTTGAGGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174439580_1174439584 24 Left 1174439580 20:50539696-50539718 CCAGGCTTTAGTGCAGTGAGGCA 0: 1
1: 8
2: 155
3: 4351
4: 59455
Right 1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 278
1174439579_1174439584 25 Left 1174439579 20:50539695-50539717 CCCAGGCTTTAGTGCAGTGAGGC 0: 1
1: 10
2: 270
3: 8103
4: 124179
Right 1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174439584 Original CRISPR CTCCTGGGCTTGAGGAACAA AGG Intronic
900465316 1:2822440-2822462 CTCCAGGGCGTGAGGAAACAGGG + Intergenic
901135409 1:6989879-6989901 GTCCTGGGCTGGAGGAATAGAGG + Intronic
903005287 1:20294182-20294204 CTCCTGGATTTGAGGTACAGAGG + Intronic
903183666 1:21617889-21617911 CTCCTGGGCTTGAGTAAGGGTGG + Intronic
904774070 1:32895998-32896020 CTCCTTGGCTGGAGGAACAGGGG + Intronic
904838586 1:33355451-33355473 CTCCTTTGCTGGAGGAACACTGG + Intronic
905134350 1:35787018-35787040 CTCCTGTGAAGGAGGAACAACGG + Intergenic
905306489 1:37022500-37022522 ATCCTAGGCTTGAGAAAGAAGGG + Intronic
912387634 1:109280191-109280213 CAAATGGGCTTGAGGAAGAAGGG - Intronic
912811071 1:112794976-112794998 CTCCTGGGGTTAAAGGACAAAGG - Intergenic
915118816 1:153616072-153616094 CGCCTGGGCTTCAGGAGCCAAGG + Intronic
915475576 1:156150890-156150912 CTCCAGGGCTTGTGGAGAAATGG + Intronic
916856020 1:168750891-168750913 GTCCTGGGCTTAAGAAAGAAAGG + Intergenic
916990068 1:170233514-170233536 CTCCTAGGTATGAGGAACAATGG - Intergenic
917144421 1:171873429-171873451 TTCCTGTGCTTGAGGAACTCAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918263134 1:182814831-182814853 GTCCATGGCTTGAGGAAGAACGG - Exonic
919797241 1:201328328-201328350 CTCCTGTGTTTGAGAAACAATGG + Intronic
920848064 1:209610062-209610084 TACCTGGGCCTGATGAACAATGG - Intronic
922133801 1:222805658-222805680 CTCTAGGGCTGGAGGAACAAAGG + Intergenic
923433314 1:233945243-233945265 CGCCTGGCCTTCAGGAGCAAAGG - Intronic
923624857 1:235605787-235605809 CTCCTGGGCTTCAGGAATAAGGG - Intronic
923944525 1:238868799-238868821 CTCCTGGGCTTGGGTCTCAAAGG - Intergenic
1063343914 10:5294081-5294103 CTCCTAGGCTAGAGAAACAGAGG + Intergenic
1064049027 10:12043954-12043976 GTCCGGAGCTAGAGGAACAAGGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065111064 10:22440263-22440285 CTCCTAGGCTTGAGCAACTTGGG - Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1065714577 10:28553556-28553578 CTCATGGTGTTGAAGAACAAAGG + Intronic
1065738399 10:28774523-28774545 ACCCTGGGCCTGAGGAACAAAGG + Intergenic
1065779900 10:29157596-29157618 CTCTGGGGCTTAAGGCACAATGG - Intergenic
1070874258 10:79787567-79787589 CTCCTGGGCTTAAGAAAAGAAGG + Intergenic
1071502496 10:86213698-86213720 CTTGTGGGCTTGAGAAATAACGG - Intronic
1071641189 10:87309721-87309743 CTCCTGGGCTTAAGAAAAGAAGG + Intergenic
1071908035 10:90196775-90196797 AGCCTGTGCTTGGGGAACAAGGG + Intergenic
1072529089 10:96301458-96301480 CCACTGGGCTGGAGCAACAAAGG + Intergenic
1074254249 10:111784483-111784505 TTCCTGGGCTTGGAGAACCAAGG + Intergenic
1074782132 10:116809655-116809677 CTCCTGGGATTCAGGAAAATTGG + Intergenic
1075421445 10:122304033-122304055 CTTCTGGGCTTGAGGACCTCAGG + Intronic
1076699781 10:132265399-132265421 GTCCTGGGCTTCTGGAACTAGGG + Intronic
1077009592 11:374311-374333 TCCCTGGGTTTGAGGACCAAAGG - Intronic
1077435883 11:2539014-2539036 CACCTGGGTTTGAGGAACCTGGG + Intronic
1077810080 11:5628063-5628085 CTGCTGGGCTTGAGCCACACTGG + Intronic
1078562007 11:12380324-12380346 CTCCGAGGCCTGAGGGACAAGGG + Intronic
1080887309 11:36378010-36378032 CTCCCGGGCTTGATCAGCAAGGG - Intronic
1082262251 11:50085612-50085634 CTTCTGGGCTTGCTGAACACAGG + Intergenic
1086425287 11:86676918-86676940 CTCCAGGGTTGGAGGAACAAAGG - Intergenic
1088599715 11:111463457-111463479 CTCCAGGGCTGGAGGATCAGAGG + Intergenic
1089349742 11:117815636-117815658 CTCCTGGGGCTGAGGAACTTCGG + Intronic
1089619440 11:119713952-119713974 CTCCTGGGCTTTGGGGGCAAGGG + Intronic
1089655256 11:119942436-119942458 CACCTGGACTGGAGGAATAAAGG - Intergenic
1091946491 12:4549563-4549585 CTCCTGTCCTTCTGGAACAACGG + Intronic
1092168343 12:6357011-6357033 CCACTGGCCTTGAAGAACAAAGG + Intronic
1099979707 12:89584294-89584316 ATCCTGGCCTTGAGGGACATAGG - Intergenic
1102992919 12:117327726-117327748 CTCCTGGGGATGAGGACCAAAGG + Intronic
1103242296 12:119423664-119423686 CTCCAGGGCTGGAGGAATTAAGG - Intronic
1105422580 13:20266186-20266208 CTCCTGGGCAGGAGGAACAGAGG + Intergenic
1105422706 13:20266911-20266933 CTCCTGGACAGGAGGAACAGAGG + Intergenic
1106035181 13:26037703-26037725 CTCCTAGGGCTGAGGCACAAAGG - Intergenic
1107330250 13:39292030-39292052 CTCATAGACTTGAAGAACAAAGG + Intergenic
1107905093 13:45054311-45054333 CTGCTGGACTTAAGGAGCAAAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114371678 14:22096168-22096190 CTCATGGACTTGAGGAGGAAAGG + Intergenic
1114441363 14:22750976-22750998 CTCCTAGGCTGGAGGGACAATGG + Intergenic
1115921425 14:38378291-38378313 CTCTTGGGAATGAGGGACAAAGG + Intergenic
1119182547 14:72614487-72614509 GTCCTGGGCTTGGGGGACAGGGG + Intergenic
1119519326 14:75274209-75274231 CTCATGGGGCTCAGGAACAAGGG + Intergenic
1119643399 14:76330772-76330794 ATCCTGGGCTTGAGGACAAAGGG + Intronic
1121555335 14:94832172-94832194 CTCCAGGGCTAGGGGAACAAAGG + Intergenic
1121918163 14:97855087-97855109 TTCCTGGGCTCCAGGAACCACGG - Intergenic
1122139760 14:99655810-99655832 CTCTTGGGTTGGAGGAACAAAGG + Intronic
1122378648 14:101286205-101286227 CTCCTGGACTTCAGGATCACAGG - Intergenic
1124226730 15:27901474-27901496 CTCATGGGCCTGAGGGGCAAAGG - Intronic
1126640360 15:50818528-50818550 CCCTGGGGCTTGAGGAATAAAGG - Intergenic
1127862812 15:63008600-63008622 CTCCTGGGCTGAAGGATAAAAGG + Intergenic
1128356107 15:66927858-66927880 CTCCTGGGCTTGGGAAATCAGGG + Intergenic
1131351705 15:91706916-91706938 CTCCAGGGTTGGAGGAACAAAGG - Intergenic
1132261899 15:100433292-100433314 CTTCTGGGGCTGAAGAACAATGG + Intronic
1132938039 16:2491921-2491943 CTCCTGGGCTTGGCGTCCAAAGG + Intronic
1135182611 16:20288781-20288803 CTCCTGGGCTCAAGGCTCAAGGG + Intergenic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1136020006 16:27434254-27434276 CTCGAGGGCTGGAGGAAGAATGG - Intronic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1137541694 16:49367337-49367359 CTCCTGGCCTTGTGGGATAAGGG - Intergenic
1139296157 16:65902897-65902919 CTCTAAGGCTTGAGGAACAGAGG - Intergenic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1142169162 16:88611542-88611564 CCCCTGGGCTTCAGGAAGCAGGG - Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1145728150 17:27152915-27152937 CACCAGGGATTGAGGAACCACGG + Intergenic
1145924228 17:28633749-28633771 CCGCTGGGGTAGAGGAACAAAGG + Exonic
1148240022 17:45994185-45994207 CTCCTTGACTTCAGGGACAATGG + Intronic
1148743683 17:49907046-49907068 CTCCTGGGGTTGAGAGTCAAAGG + Intergenic
1149854579 17:60069428-60069450 CTCCTGGTCTTGAGCATCATGGG + Intronic
1151370805 17:73645097-73645119 CTCCCGGGCCGGAGGAGCAACGG + Intergenic
1152786925 17:82253156-82253178 CTCATGGGCCTGGGGAAGAAGGG - Exonic
1155367320 18:25061418-25061440 TTCCCGGGCTGGAGGAACCAAGG + Intergenic
1156089369 18:33447089-33447111 CTCCTGGGCCTGAGAAAGCAAGG + Intergenic
1157856069 18:51106884-51106906 CTCCTGGGAGTGAGGACCACAGG - Intergenic
1157969208 18:52247027-52247049 CTCCTGGCATTTAGCAACAAGGG - Intergenic
1159304052 18:66616489-66616511 CGCCTGGGCATGAAGCACAAAGG - Intergenic
1161778758 19:6278278-6278300 CTTCTGGGCTTGAGGAAGAGGGG + Intronic
1161942823 19:7416321-7416343 CTCCTGGGCTCAAGGAATCAAGG - Intronic
1161947780 19:7449058-7449080 CTCCTGGCTTTGAGGAACTGCGG - Intronic
1162440773 19:10690771-10690793 CTCCTGTGCTTGGGTAACCATGG + Exonic
1163310936 19:16514291-16514313 CTCCTGGGTTTAAGCAACAGTGG - Intronic
1164493500 19:28736143-28736165 CTCCGGGGCTTGAGAAAAAAGGG + Intergenic
1164591447 19:29509751-29509773 CTCCTGGGCTTGAGGGTCCCAGG - Intergenic
1165446497 19:35859675-35859697 CTCCTGGGTATGAGGAAGGAGGG + Intronic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1165636507 19:37344753-37344775 TTCCGGGGCTGGAGGAATAACGG + Exonic
1165834077 19:38743846-38743868 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166142269 19:40811491-40811513 TTCCTGGGCCTGAGGAATGAGGG - Intronic
1166296672 19:41893331-41893353 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1166306307 19:41938628-41938650 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306504 19:41939183-41939205 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306696 19:41939738-41939760 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166382603 19:42362718-42362740 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1166506190 19:43373129-43373151 CTCCTGGGACTGAGGGAGAAGGG - Intergenic
1166525375 19:43507172-43507194 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166569510 19:43784819-43784841 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1166662120 19:44654096-44654118 CTCCTGGGACTGAGGGAGAAGGG + Intronic
1166686776 19:44800935-44800957 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686815 19:44801079-44801101 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686859 19:44801223-44801245 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686903 19:44801367-44801389 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686912 19:44801403-44801425 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686956 19:44801547-44801569 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686965 19:44801583-44801605 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686974 19:44801619-44801641 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166687077 19:44801944-44801966 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166687104 19:44802017-44802039 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166688474 19:44809516-44809538 CTCCTGGGTCTGAGGAAAGAGGG - Intronic
1166738983 19:45102888-45102910 CTCCTGGGCTGGAGCCACACAGG + Intronic
1167286122 19:48599704-48599726 CTCCCGGGTTTGAGGAAGGAGGG + Intergenic
1167314278 19:48754967-48754989 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314291 19:48755004-48755026 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167327298 19:48834499-48834521 CTCCTGGGTCTGAGGAAGTAGGG + Intronic
1167327705 19:48835676-48835698 CTCCTGGGTCTGAGGAAGTAGGG + Intronic
1167367909 19:49064511-49064533 CTCCTGGGTCTGAGGGAGAAGGG - Intronic
1167413839 19:49360379-49360401 CTCCTGGGTGTGAGGGAGAAGGG + Intronic
1167425496 19:49427814-49427836 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167630886 19:50625685-50625707 CTCTTGGGCCTGAGGAAGGAGGG - Intronic
1167668935 19:50838813-50838835 CTCCTGGGTTTGAGGGAGAAAGG + Intergenic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167689127 19:50974916-50974938 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167689188 19:50975083-50975105 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167738356 19:51310823-51310845 CTCCTGGGTCTGAGGGACGAGGG + Intergenic
1167741000 19:51325118-51325140 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1167746233 19:51353358-51353380 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746247 19:51353395-51353417 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746261 19:51353432-51353454 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746276 19:51353469-51353491 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746291 19:51353506-51353528 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746306 19:51353543-51353565 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746321 19:51353580-51353602 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746336 19:51353617-51353639 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746398 19:51353802-51353824 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746426 19:51353876-51353898 CTCCTGGGTCTGAGGAAGAAGGG - Intronic
1167746452 19:51353950-51353972 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746466 19:51353987-51354009 TTCCTGGGTCTGAGGAAGAAGGG - Intronic
1168106618 19:54169412-54169434 CTCCTGGGTTTGAGGGAGGAGGG - Intronic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168155516 19:54471842-54471864 CCCCTGGGTCTGAGGAAGAAGGG - Intronic
1168155878 19:54472811-54472833 CTCCTGGGTCTGAGGAAGAAGGG - Intronic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238725 19:55078821-55078843 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1168252175 19:55147351-55147373 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168252214 19:55147460-55147482 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168253531 19:55154887-55154909 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1168295387 19:55375233-55375255 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1168327859 19:55547084-55547106 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1168352444 19:55684397-55684419 GTCCTGGGCTTGAGGAGTCATGG - Intronic
925104756 2:1281899-1281921 CTCCCGGGCTTGAGGAGACACGG - Intronic
925889590 2:8422549-8422571 CTCCTGGGCTTGAGTTCCCACGG + Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
927112231 2:19871796-19871818 GTCCTGGGCTTCAGAAACCATGG - Intergenic
928084665 2:28338464-28338486 CTCCTGGAACTGAGGGACAAAGG - Exonic
928153518 2:28854834-28854856 CACCTGGGCTTGAGAAATCAAGG + Intronic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931771154 2:65499291-65499313 CTCCTGGGCTTGAAGGCCAAGGG + Intergenic
936260997 2:110959500-110959522 CTCCTGGGCTCTAGTGACAACGG - Intronic
938754673 2:134368806-134368828 CTCCTGGGCTGTAGCCACAAGGG + Intronic
939295106 2:140252598-140252620 CTCCTGGGCATGAGAAAGAAAGG - Intronic
940849159 2:158671995-158672017 CTTGTGTGCTTGAGGAACAGAGG + Intronic
941034488 2:160553369-160553391 CTCCGGGGCTGGAAGAACAAAGG + Intergenic
943053652 2:182947408-182947430 CTGGTGGCCTTGTGGAACAAGGG - Intronic
946757237 2:222959932-222959954 CACCTGGGCTTCAAGAACCATGG - Intergenic
948420639 2:237858309-237858331 CTCCTAGGGTTCAAGAACAAGGG + Intergenic
948936322 2:241167262-241167284 GCCCTGGGGTTGAGGCACAAAGG - Intronic
949059900 2:241950814-241950836 CTCTTGGGTTTGAAGAACCACGG + Intergenic
1170602762 20:17854257-17854279 CCCCAGGGCTAGAGGAACAAGGG + Intergenic
1171136595 20:22700472-22700494 CTCCTGGGCTCCAGATACAATGG + Intergenic
1171905389 20:30895175-30895197 CTCCAGGGCGTGGGGAACAGGGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175337869 20:58207704-58207726 CTCCTGGCTTTGAGGAGAAATGG - Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1178785910 21:35653024-35653046 CTCTTGGACTGGAGGAACAATGG - Intronic
1178916327 21:36707522-36707544 CTCCTGGGCTCAAGGAATTAGGG - Intronic
1180338806 22:11601289-11601311 CTCCAGGGCGTGGGGAACAGGGG - Intergenic
1180628011 22:17207433-17207455 CTCCGGGGCTTGGGGACAAAGGG + Intronic
1181439184 22:22927067-22927089 CTGCTGGGCTTGAGGCAGGAAGG - Intergenic
1181642972 22:24214462-24214484 CTCCAGGGCCTCAGGAACCAAGG + Intergenic
1182942079 22:34286467-34286489 CCCCAGGGCTGGAGGAACATGGG - Intergenic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1183806471 22:40215646-40215668 CCCCAGGGCTGGGGGAACAAAGG - Intronic
1184272398 22:43392354-43392376 CACGTGGGCTCGAGGAAGAATGG - Intergenic
1184277929 22:43420838-43420860 CTCCTGCCCTTGAGGAACATGGG - Intronic
952379671 3:32795083-32795105 CTCCTAGGCTGGAGGGTCAAGGG + Intergenic
952979927 3:38726539-38726561 CTTCAGGGCTTGAGTGACAAAGG - Intronic
954301200 3:49701705-49701727 CTCCAGGGCTTCAGGGACCAGGG - Intronic
957241103 3:77662107-77662129 AGCCTGGGTTTGAGGAACAGGGG + Intergenic
960184188 3:114618338-114618360 CTCCTGGGCTCAAGGGATAAGGG + Intronic
962248675 3:133821037-133821059 CACCTGGCCTTGAGGATCAGGGG + Exonic
962803218 3:138908112-138908134 CTCCTGGGCCTGGGAACCAAAGG - Intergenic
963371169 3:144402384-144402406 GTCCTGGGCTTCAGAAGCAAAGG - Intergenic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
964958390 3:162391942-162391964 CCCTTTGGCTTGAGAAACAATGG + Intergenic
965651101 3:170934371-170934393 ATCCTGGGCAAGAAGAACAAAGG - Intergenic
967480741 3:189969970-189969992 CTCTTTGGCTTGAAGACCAAAGG + Intronic
968425945 4:523333-523355 GTGCTGGGTGTGAGGAACAATGG + Intronic
969440646 4:7214872-7214894 CTCATGGACTTGAGGGACAGTGG + Intronic
969635253 4:8365419-8365441 CTCCTGGGTTCGAGTGACAATGG + Intergenic
970673563 4:18422774-18422796 CTCTTGGCCTTAAGGAACAAGGG - Intergenic
972385609 4:38562828-38562850 CTCCTAGGCTGGAGGGACAAAGG + Intergenic
976061189 4:81130444-81130466 CTCCCCGGCAGGAGGAACAAGGG + Intronic
977222479 4:94354401-94354423 CTCCTGGCCTACAGGAACAAAGG + Intergenic
979298342 4:119057690-119057712 CTTCTGGGTTTGAGGAATATAGG - Exonic
979531250 4:121771359-121771381 CTCCTGGACTAGAGAAGCAAAGG + Intergenic
981631272 4:146821279-146821301 CTCATGGGGTTGAGCAACCATGG - Intronic
984357037 4:178674624-178674646 CTCCTGGGATTTTGGGACAATGG - Intergenic
985950675 5:3219500-3219522 CTCCTGCTCATCAGGAACAATGG - Intergenic
986054603 5:4123830-4123852 CACCTGGGCTTGAGGATCACGGG - Intergenic
986839377 5:11678843-11678865 CTCATTGGCTCCAGGAACAAAGG + Intronic
992544494 5:77798522-77798544 CTCCTAGAATTGGGGAACAAAGG + Intronic
992644247 5:78797420-78797442 CACCTGGGCTAGAGGCACTATGG - Intronic
992749414 5:79848749-79848771 TTCCTGGGCTTGGGTATCAACGG - Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
993372083 5:87105408-87105430 CTCTTAGGTTGGAGGAACAAAGG + Intergenic
994040701 5:95256524-95256546 CCCCTAGGCTGGAGGAACAGAGG - Intronic
994163867 5:96587253-96587275 CTTCTGAGCTAGAGGGACAAAGG - Intronic
995946769 5:117657297-117657319 TTCCTGGGAATGAGGAAGAAAGG + Intergenic
998228552 5:140345047-140345069 CTCCTGGGAATGAGGGAGAAGGG + Intronic
999393122 5:151208678-151208700 ACCCTGGGCTGGAGGAAGAAGGG + Intronic
999888038 5:155945700-155945722 CTTCTGGGCTTCAGGAACACTGG - Intronic
1000909358 5:167002680-167002702 CTCCTGGGCTCGAAGAACAGGGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006781408 6:36634917-36634939 CCCTCGGGCTGGAGGAACAAAGG + Intergenic
1006879663 6:37327873-37327895 TTCTTGGGCTTGGGGATCAAAGG + Intronic
1007721058 6:43885726-43885748 CTCCTGGGCCTGGGGGACACAGG - Intergenic
1007923104 6:45628597-45628619 CCCTAGGGCTGGAGGAACAAAGG + Intronic
1008142678 6:47850130-47850152 CATCTGGGCTTGAGCAAGAACGG + Intergenic
1008148901 6:47926165-47926187 CTCCTGGAGATGAGGAGCAAAGG + Intronic
1011723311 6:90182010-90182032 CTCCTGAGATTGACGAATAATGG - Intronic
1014458661 6:121668392-121668414 CTCCTGGGCTGGAGTGACAGTGG + Intergenic
1015585281 6:134770108-134770130 CACCTGGCCTTGTAGAACAATGG - Intergenic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1018123491 6:160659586-160659608 CCCTTGGGCTTGAGAAAGAAGGG - Intronic
1019280238 7:196039-196061 CTCCTGGGGTAGAGGAATAGAGG + Intronic
1020580135 7:9987478-9987500 CTCCTCTGCTAAAGGAACAAAGG + Intergenic
1022246443 7:28564507-28564529 CTCCTGAGCTTGAGGTAGAGTGG - Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023966299 7:44964758-44964780 ATCCTGGGCTTCAGGAGCAGTGG - Intronic
1027209684 7:76135537-76135559 CTCCTGGGTTGGAGGCAAAAGGG - Intergenic
1028094627 7:86744897-86744919 AGCCTGGGTGTGAGGAACAAAGG - Intronic
1031890388 7:127287250-127287272 CCCCTTGGCTGGGGGAACAAAGG + Intergenic
1033426940 7:141253159-141253181 CCCCTAGGCCTGAGGAACCAGGG - Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035215498 7:157363527-157363549 ATCCTGGGTTTGAGGAACCTGGG + Intronic
1035330532 7:158094206-158094228 CCCCTGTGCTGGGGGAACAAGGG - Intronic
1035977464 8:4329027-4329049 CTCCAGGGCTTGACTTACAAAGG - Intronic
1036601770 8:10267592-10267614 CTTCTGGGCTAGAAGCACAATGG - Intronic
1039212000 8:35227893-35227915 CTCCTGGGCATGAGCAACAGAGG - Intergenic
1039821827 8:41141712-41141734 CCACTGGGCTTAAGGAACAAGGG - Intergenic
1043330956 8:79117911-79117933 TTCATGGGCTGGAGGAACAGGGG + Intergenic
1045400575 8:101812674-101812696 CACTTGGGATTGAGTAACAATGG + Intronic
1046683496 8:117198246-117198268 CTCCTGAGTGTGAGAAACAAGGG - Intergenic
1047208197 8:122820130-122820152 CCCCTGGGTTTGAGTAAGAATGG - Intronic
1047600080 8:126417380-126417402 CTCTTTGGCTTGGGGAACATAGG + Intergenic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1050958139 9:11690423-11690445 CACCTGAGCAAGAGGAACAATGG - Intergenic
1051936277 9:22446797-22446819 CTTCTTGGCTGGAGGCACAAAGG + Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1054959703 9:70954246-70954268 CCACTGGGCTGGAGGAATAATGG - Intronic
1055124050 9:72698680-72698702 CCCAAGGGCTGGAGGAACAATGG + Intronic
1055541543 9:77311282-77311304 CTTATGGGCTGGAGGAAGAAGGG - Intronic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1057962178 9:99467393-99467415 CTCCAGGGCTTAGGTAACAAAGG + Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061556343 9:131372089-131372111 CCCTTGGGCTTGCTGAACAAGGG - Intergenic
1061836501 9:133333203-133333225 GACCTGTGCTTCAGGAACAAGGG + Intronic
1185873239 X:3681789-3681811 TTGCTGGGCTTGAGGAAGAGAGG - Intronic
1186665698 X:11714822-11714844 CTCTTGGGCTGAAAGAACAAAGG + Intergenic
1187016291 X:15332771-15332793 CTACTGTGCTAGAGGGACAAGGG + Intronic
1187166049 X:16804895-16804917 TTCCTGGGGTGGAGGGACAACGG - Intronic
1187701656 X:21969234-21969256 AGCCTGGGCTTGGGGAAGAAGGG - Intronic
1188820174 X:34765554-34765576 CTCCTAGGCTAGAGGTACTAGGG + Intergenic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1195606211 X:106808390-106808412 TTTCTGGGCCTGAAGAACAAAGG + Intronic
1197310993 X:124905258-124905280 CACCTAGGCTTGAGTAACAGTGG - Intronic
1197869339 X:131050650-131050672 CTCCTGGGATGGAGGAATACAGG + Intergenic
1197870152 X:131057104-131057126 CCCCTGGGCTTGAAGTAAAAAGG + Intergenic
1200791063 Y:7299324-7299346 TTGCTGGGCTTGAGGAAGAGAGG + Intergenic