ID: 1174440209

View in Genome Browser
Species Human (GRCh38)
Location 20:50545501-50545523
Sequence CTTTTTCAGACTAATCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174440209 Original CRISPR CTTTTTCAGACTAATCCATG AGG (reversed) Intronic
900699600 1:4036995-4037017 CTCTTTCAGACTTTTCGATGTGG - Intergenic
903317845 1:22522613-22522635 GTTTTTCACACTACTCTATGAGG - Intronic
908423210 1:63979806-63979828 CGTTTTCAGATTCATCCATGTGG - Intronic
909190080 1:72540069-72540091 CTTTTGTAGACCAATCCCTGTGG + Intergenic
909230116 1:73077968-73077990 GCTTTTGAGATTAATCCATGTGG - Intergenic
909543680 1:76819323-76819345 ATTTCTCAGACTGATCCATATGG + Intergenic
910009669 1:82445613-82445635 CTTTTTCAAAACAATCCTTGTGG + Intergenic
910281530 1:85506725-85506747 CTTATTCAGACTTTACCATGTGG + Intronic
910519376 1:88101708-88101730 CTTTTTCAGACACCTCCCTGAGG + Intergenic
914835096 1:151199978-151200000 CTTTCTCAGACTAATTCCTTTGG + Intronic
914867984 1:151448989-151449011 CTTTTTCAAGCAAATGCATGAGG + Intronic
917620797 1:176793783-176793805 CTTTCTAGGAATAATCCATGTGG - Intronic
918075920 1:181171421-181171443 CTTTTTCAGACTTACCCACCTGG - Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919479954 1:198076111-198076133 CTAGTTCAGATTAATTCATGGGG + Intergenic
919930161 1:202215927-202215949 CTTCCTCAGACTAATCCCTTTGG - Intronic
922426168 1:225496946-225496968 CTTTTTTAGATTTATGCATGTGG - Exonic
923794355 1:237139228-237139250 GTTTTCAAGACTCATCCATGTGG - Intronic
923810103 1:237305321-237305343 ATTTTTGAGATTAATCCATGTGG - Intronic
923901714 1:238333216-238333238 GTTTTTGTGACTTATCCATGTGG - Intergenic
923948401 1:238918691-238918713 ATTTTTGAGATTCATCCATGTGG - Intergenic
924112090 1:240710291-240710313 CTTTTAGAAACTAATCCATGTGG - Intergenic
1063169470 10:3494647-3494669 CTTTATCTGGCTATTCCATGGGG + Intergenic
1064061164 10:12138659-12138681 CTTTTTGAGATTAATTCATATGG + Intronic
1065356636 10:24848290-24848312 CTTTTGCAGACTTATCCCTTGGG + Intergenic
1067399137 10:45955078-45955100 GTTTTCAAGATTAATCCATGTGG + Intergenic
1067867458 10:49924294-49924316 GTTTTCAAGATTAATCCATGTGG + Intronic
1068054024 10:51988264-51988286 ATTTTTGAGATTTATCCATGTGG + Intronic
1068816977 10:61327506-61327528 GTCTTTGAGATTAATCCATGTGG - Intergenic
1069456322 10:68556915-68556937 TTTTTTCAGTCTACTCAATGTGG + Intergenic
1069745419 10:70712031-70712053 CTTTCTCAAACAACTCCATGTGG - Intronic
1071575109 10:86719472-86719494 CCTTTTCAGACTAGACCTTGTGG - Intronic
1071739579 10:88341828-88341850 CTATTTCATACTAATCTGTGAGG + Intronic
1072200829 10:93157283-93157305 ATTTTTCAAATTGATCCATGTGG + Intergenic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1075359944 10:121822235-121822257 CTTTGTGAGATTTATCCATGTGG - Intronic
1075976487 10:126700607-126700629 CTTTTCCACACTCATTCATGTGG - Intergenic
1080999144 11:37645828-37645850 CTTTCCCAGTTTAATCCATGTGG + Intergenic
1081929293 11:46857604-46857626 CTTTTTCTGACCAAGCCTTGTGG - Exonic
1083268819 11:61560382-61560404 CTTTTGCAGAATATTCCATTTGG + Intronic
1085883551 11:80496483-80496505 CAGTATCAGACCAATCCATGTGG - Intergenic
1085904636 11:80745670-80745692 GTTTTCCAGACTAATACATACGG + Intergenic
1086106624 11:83154591-83154613 CTTTTTCACATTACTACATGAGG + Intergenic
1087086464 11:94223724-94223746 TTTCTTCACAATAATCCATGGGG - Intergenic
1089266425 11:117266004-117266026 ATTTTTGAGATTCATCCATGAGG + Intronic
1092671073 12:10861066-10861088 CTTTTTCAGACTGTTCCCTGTGG - Intronic
1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG + Exonic
1094380635 12:29839890-29839912 CTTTTCCAAAATAATCAATGTGG - Intergenic
1095121017 12:38419043-38419065 CTTTTCCAGACAAACACATGCGG + Intergenic
1099304235 12:80935731-80935753 TTTTTTCAGACTCATCCACAGGG + Intronic
1104252782 12:127111381-127111403 CCATTTCAGTCTAATCCATTTGG - Intergenic
1106292568 13:28378620-28378642 GTTTTACAGACTAATGGATGAGG - Intronic
1106355711 13:28981244-28981266 TTGTTTGAGATTAATCCATGTGG - Intronic
1109079361 13:57878477-57878499 GTTCTTCAGACTAATCCCTCTGG - Intergenic
1110481185 13:75978716-75978738 CCTTTTCATCTTAATCCATGGGG - Intergenic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1113141039 13:107149698-107149720 CATTTTGAGACTTATTCATGTGG + Intergenic
1114943855 14:27652948-27652970 CTTTTCCAGCCTAAACCTTGTGG + Intergenic
1116345134 14:43784140-43784162 CTTTTTTAGGCTCATCCCTGTGG + Intergenic
1116406251 14:44569589-44569611 CTTTTTCAGACAAATAAATGCGG + Intergenic
1116435988 14:44896294-44896316 CTTTTTTAGAGAGATCCATGAGG + Intergenic
1116941277 14:50793314-50793336 GTGTTTCAGACTAATTGATGTGG - Intronic
1117332348 14:54725556-54725578 CATTTTCAGCCTATTACATGTGG - Intronic
1118054213 14:62062525-62062547 TTTTTTCAGACTATTCCCTGAGG - Intronic
1124415711 15:29471797-29471819 CTTTTTCAGAAGAAGGCATGAGG - Intronic
1124941813 15:34225270-34225292 CTTTTTCAGAGTTATGCCTGAGG - Intronic
1127141488 15:55982455-55982477 TTTTTTGAGAGTCATCCATGGGG - Intronic
1130208440 15:81900498-81900520 CTTTTTCAGAATAAGACTTGAGG + Intergenic
1131030464 15:89182116-89182138 TTTTTTGAGAATAATCCATAAGG - Intronic
1136748111 16:32609953-32609975 TTTTCTCAGACAAATCCAGGTGG - Intergenic
1137048187 16:35687363-35687385 CTCTTTCATACTAATACTTGGGG + Intergenic
1140232387 16:73128161-73128183 CTTTTTCTGACTGATACAGGGGG + Intronic
1203050247 16_KI270728v1_random:869160-869182 TTTTCTCAGACAAATCCAGGTGG - Intergenic
1144133323 17:12268564-12268586 CTCTTTCAGGCTGCTCCATGTGG - Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144591690 17:16529454-16529476 CTTTTTCAGATTTATCCATGTGG - Intergenic
1153664516 18:7357005-7357027 ATTTTACAGATTTATCCATGTGG + Intergenic
1154454371 18:14507636-14507658 CTTTTGCAGACTTATGTATGTGG + Intronic
1156563106 18:38151845-38151867 ATTTTACAGACTATGCCATGTGG - Intergenic
1157370537 18:47107039-47107061 CTTTTTCAGACTGTTAAATGTGG + Intergenic
1157664167 18:49471465-49471487 CTTTTTGAGATTCACCCATGTGG + Intergenic
1159830841 18:73276743-73276765 CTTTTTCAGGCCAATGCAGGAGG - Intergenic
1163628178 19:18402815-18402837 ATGTTTCAGACTATCCCATGGGG - Intergenic
1164656201 19:29923823-29923845 GTTTCTCTGACTAATCCATGTGG - Intronic
1164837004 19:31362512-31362534 GTTTTTCGGACTTAACCATGTGG + Intergenic
1166245934 19:41525639-41525661 ATTTTTGAGAATGATCCATGTGG - Intergenic
927287738 2:21374247-21374269 ATTTTTCAAATTAATCAATGAGG + Intergenic
927908046 2:26876065-26876087 CTTTTTCAGACTCAACCATCAGG + Intronic
928721085 2:34122199-34122221 CTTTTTCACATTAATTTATGAGG + Intergenic
929480282 2:42300001-42300023 GTTTTTAAGATTCATCCATGTGG + Intronic
930816040 2:55598979-55599001 CTTCTTCAGATTCATCAATGAGG + Exonic
933061364 2:77740848-77740870 CTTTTTCTTATTAATGCATGAGG - Intergenic
935134136 2:100284479-100284501 CTTTTGCAGAGTAATCCCAGCGG - Exonic
935322565 2:101903064-101903086 TTGTTTCAAACTAAGCCATGAGG - Intergenic
935712583 2:105912504-105912526 CTTCTCCAGACAAATCCCTGGGG + Intergenic
936430329 2:112457127-112457149 CTTTCTAATTCTAATCCATGAGG - Intergenic
940259405 2:151764817-151764839 CTTTTCAAGATTTATCCATGTGG - Intergenic
941118280 2:161497329-161497351 CATTTTCACAGTAATGCATGAGG + Intronic
941428321 2:165379275-165379297 ATTTTTAAGGCTCATCCATGTGG - Intronic
944430015 2:199623048-199623070 CTTCTTCTGAATAACCCATGTGG + Intergenic
944995748 2:205291769-205291791 CTTTTTCAGACTTTTCAATATGG - Intronic
945591738 2:211740929-211740951 CTTTTTCAAATTAATCAATTTGG - Intronic
1169569985 20:6895721-6895743 CTTTTTCAGATGACTCTATGTGG + Intergenic
1169933761 20:10860987-10861009 CTTTTTCATACTATGCCATATGG + Intergenic
1170248642 20:14253877-14253899 CTTTTTCAGTCTAAACCAATGGG + Intronic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1172122838 20:32608735-32608757 CTTTGTCTGTCTCATCCATGAGG + Exonic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1175436993 20:58959980-58960002 CTTTTTCAGCCTGGGCCATGGGG - Intergenic
1175440623 20:58988519-58988541 GTTTTTCTGGCTACTCCATGTGG + Intronic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1178436248 21:32561178-32561200 CTTGTTCCGACCTATCCATGCGG - Intergenic
1183106238 22:35617252-35617274 CTTCTTCAGACTGCGCCATGGGG - Exonic
1183134078 22:35869734-35869756 CTTCTTCAGACTAAAAGATGAGG - Intronic
950344251 3:12277494-12277516 GTTTTTGAGGCTCATCCATGTGG + Intergenic
950927386 3:16755302-16755324 CTTTTTCAGATTATTCACTGTGG + Intergenic
953604071 3:44397427-44397449 CATTTTGAGATTCATCCATGTGG + Intronic
953782330 3:45882224-45882246 TTTTTCCCCACTAATCCATGAGG - Intronic
955334393 3:58073028-58073050 GTTTTGCAGACTAATGCCTGTGG + Intronic
956197024 3:66663146-66663168 CTTTTACTGACTTATTCATGTGG + Intergenic
956377576 3:68632042-68632064 CCTTTTCAGATCACTCCATGGGG + Intergenic
956949407 3:74263718-74263740 CTTTTAAAAACTAATTCATGGGG + Exonic
964491725 3:157243301-157243323 GTTTTTGAGATTCATCCATGTGG - Intergenic
970654525 4:18216577-18216599 ATTTTTGAGATTAATCAATGTGG - Intergenic
971523422 4:27585004-27585026 CTTTTTCAGATTGTTCAATGTGG - Intergenic
972839159 4:42910517-42910539 CTTTTTCTGACTCCTCCATGGGG - Intronic
974877243 4:67715139-67715161 CTTTCTCAGACTACTCAATATGG - Intergenic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
977572725 4:98646302-98646324 CTATTTCAGACAAATTCTTGAGG - Intronic
977696755 4:99974102-99974124 CTGTATTAGACTAATCCTTGAGG + Intergenic
977852876 4:101851291-101851313 CTTTTTCAGAGCAAGGCATGTGG + Intronic
981175528 4:141678525-141678547 CTGCTTCAGAAAAATCCATGGGG - Intronic
982989560 4:162254823-162254845 ATTTTTGAGATTGATCCATGTGG - Intergenic
984857509 4:184207676-184207698 CTTTTTCACACTACTCCAACTGG + Intronic
985332696 4:188857580-188857602 CTTCTTCAGACAAATGCAGGTGG + Intergenic
987604655 5:20116859-20116881 TTTTTCCAGAAAAATCCATGTGG + Intronic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
988202511 5:28085505-28085527 CATTTTAAGACTAATCAAAGGGG - Intergenic
989721079 5:44529165-44529187 TTTTTTCAGAATAATGCATTTGG - Intergenic
990547657 5:56839116-56839138 CTACTTCAGAGTAATCCATATGG + Intronic
993761791 5:91804569-91804591 CTTTTTCATAGTATTCCATTGGG + Intergenic
996914211 5:128692981-128693003 CTTTGTAAGACTAAACCATCCGG + Intronic
996947424 5:129087280-129087302 CTTTTGCAGTCTTCTCCATGGGG - Intergenic
998189575 5:140011660-140011682 GTCTTTCAGACTCATTCATGTGG - Intronic
999910861 5:156197315-156197337 GTGTTTCAAACTAATCCGTGAGG - Intronic
1001664301 5:173419903-173419925 CCTTTTCAGACTAAGACATTTGG - Intergenic
1001988132 5:176093281-176093303 TTTTCTCAGACAAATCCAGGTGG - Intronic
1002228736 5:177744859-177744881 TTTTCTCAGACAAATCCAGGTGG + Intronic
1002266610 5:178038924-178038946 TTTTCTCAGACAAATCCAGGTGG - Intronic
1003066582 6:2909011-2909033 ATATTTCAGACTATCCCATGGGG - Intergenic
1005887784 6:30110283-30110305 CATTTTCATTCTAATACATGCGG + Intronic
1006029116 6:31166140-31166162 CTTCTACAGACTATTCCTTGGGG - Intronic
1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG + Intergenic
1007049120 6:38808088-38808110 GTTTTTGAGATTCATCCATGGGG + Intronic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1010609980 6:77942694-77942716 CTTTTCCAGAGTAGCCCATGTGG - Intergenic
1010864519 6:80958378-80958400 ATTTTTGAGAATCATCCATGTGG - Intergenic
1013253385 6:108358124-108358146 CTTTTTCAAACGACTCAATGAGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1016513172 6:144865778-144865800 CTTTTTCAGACTGATCCCACTGG + Intergenic
1016866980 6:148777282-148777304 CTTATTCAGAGTCATCCATCAGG - Intronic
1017224929 6:152009934-152009956 ATTTTTAAGACTTAGCCATGTGG - Intronic
1017348946 6:153417325-153417347 CTTGTTCAGACCTATCCATGGGG - Intergenic
1017647622 6:156553597-156553619 CTTTTTCAGCATAATCCGGGTGG + Intergenic
1017652694 6:156597702-156597724 CTGTTTCATAATAATACATGAGG - Intergenic
1018137769 6:160794463-160794485 CTTGTTCAGACCTATCCATGCGG + Intergenic
1019697779 7:2456750-2456772 CTTTTTAAATATAATCCATGGGG + Intergenic
1020561745 7:9736777-9736799 CTTTTTCAGACTAGTTCCTATGG - Intergenic
1020764377 7:12302258-12302280 CCTTTTCAGAGTTATCCATGTGG + Intergenic
1025246654 7:57322735-57322757 CTATCTCAGACCAATCCCTGGGG + Intergenic
1026223076 7:68417289-68417311 GTTTTTCTGACTAATCTAGGTGG - Intergenic
1027840421 7:83303989-83304011 TGCTTTCAGAATAATCCATGGGG - Intergenic
1028401760 7:90432662-90432684 CTTTTTCAGACAAATGCTGGGGG + Intronic
1029534775 7:101150451-101150473 ATATTTCAGACTATCCCATGGGG + Intergenic
1030473940 7:110003852-110003874 CTTTCTCTGACTAATGCAGGTGG + Intergenic
1030718326 7:112837493-112837515 TTTTTTGACACAAATCCATGTGG + Intronic
1033212116 7:139467752-139467774 ATATTTCAGACTATCCCATGGGG - Intronic
1033243629 7:139701244-139701266 GGTTCTCAGACTAATCCAGGTGG - Intronic
1033349885 7:140553575-140553597 ATATTTCAGACTATCCCATGAGG + Intronic
1035683250 8:1504144-1504166 CTTTCTCAGACAAATACATCAGG - Intronic
1040769639 8:50957284-50957306 CCTTTCCAGGCTAAGCCATGCGG + Intergenic
1042588706 8:70372904-70372926 ATTTTTGAGACTCATCCATATGG + Intronic
1044288005 8:90431944-90431966 ATCTTTCAAAGTAATCCATGAGG - Intergenic
1045348865 8:101319638-101319660 CTTTGTCTGACTAATCCAAATGG - Intergenic
1046310727 8:112433410-112433432 CTTTGTGAGACCAATCCAGGAGG + Intronic
1048657743 8:136560441-136560463 CTCTTTCAGAATCATCCTTGAGG - Intergenic
1048689445 8:136944282-136944304 CTATTCCATTCTAATCCATGTGG - Intergenic
1050829668 9:9995388-9995410 CTTTGTCATGCTAATTCATGAGG + Intronic
1053209388 9:36214862-36214884 CTTTTTCACACTAACCCACTAGG + Exonic
1053262466 9:36680891-36680913 GATTTTGAGACTTATCCATGTGG + Intergenic
1058970638 9:110079559-110079581 CTTTTCCACACTATTCCTTGTGG - Intronic
1059486148 9:114628425-114628447 CTTTTCCTGTCTAATCCCTGTGG + Intronic
1060061302 9:120462602-120462624 GTTTTTGAGATTCATCCATGTGG - Intronic
1060458841 9:123828345-123828367 CTTTTTCAGTGTTATCCATTTGG - Intronic
1203456765 Un_GL000219v1:175558-175580 ATATTTCAGACTATCCCATGGGG - Intergenic
1186026718 X:5321317-5321339 GTTGTTCTGACTAATGCATGGGG - Intergenic
1189220218 X:39365374-39365396 CTTTTCTCGACTCATCCATGAGG - Intergenic
1191027916 X:55935637-55935659 GTTTTTGAGATTTATCCATGTGG - Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1191829238 X:65397981-65398003 CTTTTTCAGAATATTCTATGTGG - Intronic
1192769274 X:74170064-74170086 CTTTTTCACACTACTCAAAGGGG - Intergenic
1193476752 X:81975590-81975612 CTTGTCCAGAATAATCCACGGGG + Intergenic
1193617475 X:83708068-83708090 CATTTTCAGACAAATAAATGTGG - Intergenic
1197664444 X:129208950-129208972 CTTTTTCAGACAAACAAATGTGG - Intergenic
1199486618 X:148355481-148355503 CTTCTCAAGAATAATCCATGAGG + Intergenic
1200415022 Y:2900610-2900632 CTTTTTCAGACAAACAAATGTGG + Intronic
1200713799 Y:6514428-6514450 CTATATCAGAGTAATCTATGGGG - Intergenic
1200891842 Y:8332318-8332340 TTATTTCATAATAATCCATGTGG - Intergenic
1201020027 Y:9646731-9646753 CTATATCAGAGTAATCTATGGGG + Intergenic