ID: 1174442642

View in Genome Browser
Species Human (GRCh38)
Location 20:50568180-50568202
Sequence TTTCGCTGCCTGGTAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174442635_1174442642 8 Left 1174442635 20:50568149-50568171 CCCAGCCCTGAACTGAGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG 0: 1
1: 0
2: 3
3: 6
4: 123
1174442637_1174442642 7 Left 1174442637 20:50568150-50568172 CCAGCCCTGAACTGAGATGCGGA 0: 1
1: 0
2: 2
3: 6
4: 97
Right 1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG 0: 1
1: 0
2: 3
3: 6
4: 123
1174442639_1174442642 2 Left 1174442639 20:50568155-50568177 CCTGAACTGAGATGCGGAAATCG 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG 0: 1
1: 0
2: 3
3: 6
4: 123
1174442638_1174442642 3 Left 1174442638 20:50568154-50568176 CCCTGAACTGAGATGCGGAAATC 0: 1
1: 0
2: 0
3: 20
4: 159
Right 1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG 0: 1
1: 0
2: 3
3: 6
4: 123
1174442634_1174442642 18 Left 1174442634 20:50568139-50568161 CCTTGGTTGGCCCAGCCCTGAAC 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG 0: 1
1: 0
2: 3
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174442642 Original CRISPR TTTCGCTGCCTGGTAGAAAA TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901175629 1:7296877-7296899 TTTAGCTGCCTGGACAAAAAGGG + Intronic
901757213 1:11448730-11448752 TTTCGCTCCCTTGTAGAAAAGGG + Intergenic
907189945 1:52640224-52640246 TTTCGCTCCCTGTTAGTTAATGG - Intronic
907879821 1:58537518-58537540 TATTGTTGCCTGGTAGAAATTGG - Intronic
911251546 1:95582088-95582110 TTTTAGTGGCTGGTAGAAAAAGG + Intergenic
916151345 1:161794730-161794752 TGTTGCTGGTTGGTAGAAAATGG - Intronic
916153534 1:161820850-161820872 TTTCTCTCCCTGCTGGAAAAGGG + Intronic
918775646 1:188626736-188626758 TTTCCCTGCTAGGTAGATAAAGG + Intergenic
920889028 1:209964477-209964499 TTTTGTTGCCTAGTAGAAAAGGG + Intronic
920922208 1:210307422-210307444 TGTCTGAGCCTGGTAGAAAAGGG - Intergenic
921529968 1:216269761-216269783 TTTTGCTGCATGGTCCAAAATGG - Intronic
921810339 1:219505320-219505342 TATCCCTGTCTTGTAGAAAAGGG - Intergenic
921824526 1:219657521-219657543 TTTCACTGCCTAGGAGAACAGGG - Intergenic
923373051 1:233331859-233331881 TGTTGCTACCTGTTAGAAAAGGG - Intronic
924105119 1:240641937-240641959 TTTCTCTGGCTGATAGAAGAAGG + Intergenic
924738306 1:246779159-246779181 TCTCCCTGCCTGGAGGAAAAAGG + Intergenic
1064100628 10:12460979-12461001 CTTTGCTTCCTGGTAGATAAAGG + Intronic
1064342523 10:14499824-14499846 TATCTCTGCCAGGTAGAAAAGGG + Intergenic
1066514546 10:36142719-36142741 TCTATCTGCTTGGTAGAAAAGGG + Intergenic
1070239306 10:74662263-74662285 TTTGGCAGCCTGATAGAGAACGG - Intronic
1072239444 10:93481748-93481770 TTTCTCTGCCTGTGAGAAATGGG - Intronic
1072969611 10:100006111-100006133 TTTCCCTTCCTGATTGAAAAAGG - Intronic
1073179038 10:101573073-101573095 TTTCTCTGGCTGGTAGCAGAAGG - Intronic
1073626705 10:105105562-105105584 GTTGGCTGCCTGCTAGGAAAAGG + Intronic
1076105980 10:127824096-127824118 TTTCTCAGCCTGGTGGAAGATGG - Intergenic
1080208051 11:29754152-29754174 TTTCATTGCCAGGTAGACAATGG + Intergenic
1083233263 11:61336495-61336517 TTTCACAGCCTGTTTGAAAAAGG + Intronic
1084517816 11:69645965-69645987 ATCCGCTGCCTGGTTGTAAAGGG - Intronic
1085148101 11:74222298-74222320 AATCGCTGCCTAGGAGAAAAAGG - Exonic
1085189012 11:74601613-74601635 TTTTTCTTCCTGGTAGAAACAGG - Intronic
1087880015 11:103405094-103405116 TTCCGAAGCCTGGTAGAATAAGG + Intronic
1091957794 12:4662182-4662204 TCTAGCAGCCTGTTAGAAAAAGG - Intronic
1093165853 12:15803871-15803893 TTTCACTGCCTAGTTGAAGACGG - Intronic
1093235539 12:16605205-16605227 TTTAGCTTCCTGGTAACAAATGG + Intronic
1095230675 12:39735468-39735490 TCTAGCTGCCTGTTATAAAATGG + Intronic
1095305074 12:40628978-40629000 TTTTTCTGCCTGGTAGAAAAAGG + Intergenic
1096812110 12:54177637-54177659 TTTCTCTGAGTGGTAGAGAATGG - Intronic
1097804859 12:63954170-63954192 TTCCTCTGCCTAGGAGAAAAAGG + Intronic
1101194152 12:102365553-102365575 TTTCCCTGCCAAGTAGTAAAAGG - Intergenic
1102812014 12:115832630-115832652 TGTCCTTGCCTGGTAGAGAAAGG + Intergenic
1106461274 13:29972400-29972422 CTGCCCTTCCTGGTAGAAAAGGG - Intergenic
1109103672 13:58220717-58220739 ATTCTCTGCCAGGTAGTAAAAGG - Intergenic
1112918438 13:104579353-104579375 TTTCTGTGCCTGGGAGGAAAGGG + Intergenic
1115228657 14:31133410-31133432 TTTCCCTGTCAGGTAGAAATTGG + Exonic
1117410516 14:55446659-55446681 TTTCGCTGCCCAGGAAAAAACGG + Intronic
1117414059 14:55477496-55477518 TTTCTCTGGCTGGTAGCAGAAGG - Intergenic
1119991523 14:79203135-79203157 TTTCACTGCCTGGAGGAAGATGG + Intronic
1122959270 14:105087211-105087233 TTTCCCTGCCTGGGAAACAAAGG - Intergenic
1128363707 15:66981991-66982013 TGTGGCTGCCTGGGAGAAACAGG + Intergenic
1135650062 16:24198112-24198134 TTTTGCTGACTTGTAGCAAAAGG + Intronic
1137900598 16:52263805-52263827 TTTCAATGCCTGCCAGAAAAGGG - Intergenic
1137941752 16:52694805-52694827 TTTGACTGCATGGTGGAAAATGG - Intergenic
1143974882 17:10822342-10822364 GATTGCTGCCTGGGAGAAAATGG - Intergenic
1150296013 17:64007935-64007957 TTTCCCTGCCTGGTTGCAAAAGG - Intronic
1150634940 17:66906269-66906291 TTTCTCTACCAGGTAGAGAACGG + Intergenic
1155145363 18:23078688-23078710 TTTCTCTGCCAACTAGAAAAGGG - Intergenic
1156072385 18:33228656-33228678 TTTGGGGGCATGGTAGAAAATGG - Intronic
1156675697 18:39524896-39524918 TTTCACTTCATGGGAGAAAAGGG + Intergenic
1164845007 19:31424567-31424589 TTTCTCTGCCTGGCAGACATAGG - Intergenic
929365375 2:41149104-41149126 TTTAGTTGGATGGTAGAAAAAGG - Intergenic
940191992 2:151050877-151050899 TTTCTCTCCCTGGTAGAGAAGGG - Intergenic
943539466 2:189194298-189194320 TTTCTCTCACTCGTAGAAAAGGG + Intergenic
945283721 2:208061444-208061466 TTTGGCTGCCATGGAGAAAATGG - Intergenic
947121259 2:226817655-226817677 TGTCTCTGCCTGGAAGAATAGGG + Intergenic
1169479103 20:5961477-5961499 TTTCTCTGACTGGAAGAAGAGGG + Intronic
1170069392 20:12348416-12348438 TTGCTCTCCCTCGTAGAAAAGGG - Intergenic
1170277667 20:14609840-14609862 TTTCTCTCCATTGTAGAAAATGG - Intronic
1173279435 20:41615569-41615591 TTTCCCCGCCTGGTATAAGAAGG - Intronic
1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG + Intronic
1176927785 21:14771093-14771115 TTTCTCTGGCTGGTAGCAGAAGG + Intergenic
1177894977 21:26846435-26846457 TTTCCCTTCCTGGTAGGAAGAGG - Intergenic
949388246 3:3529810-3529832 TTTAGCTGGCTGGTTGCAAAAGG - Intergenic
950616685 3:14165557-14165579 CTTCTCTGCCTGCTAGCAAATGG - Exonic
951268901 3:20602076-20602098 TTTCCCTGCCTGGTGGCAACAGG + Intergenic
951410730 3:22362838-22362860 TTCTGCTGCCTGGTAGACATAGG - Intronic
956254501 3:67269617-67269639 TTTCCCTCTCTGGTATAAAAAGG - Intergenic
957257301 3:77854798-77854820 TTTCCCTGGCTCTTAGAAAAGGG - Intergenic
959620162 3:108391367-108391389 TTTCTCTGGCTGTCAGAAAATGG + Intronic
960393377 3:117106584-117106606 TGTCTCTACATGGTAGAAAATGG + Intronic
966821991 3:183932205-183932227 TTTTGCTTCCTGATAGAAGAAGG - Intronic
968793562 4:2686905-2686927 TATCGCTGCTTTGTAGAAATGGG + Intronic
970291429 4:14576890-14576912 TTTTGCTGCCTGGGAGAATTTGG + Intergenic
975720281 4:77242546-77242568 TTTGGCAGCGTGGTAGAATATGG + Intronic
980420665 4:132555980-132556002 TTTCGCTGAGTGGTATCAAAAGG - Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
982842582 4:160210248-160210270 TTTGGCTGCTTGGTAGAGAATGG - Intergenic
983324295 4:166233717-166233739 TTTCTCTGCCAGGTTGATAAGGG + Intergenic
983719321 4:170827668-170827690 TTTGTCTGCTTTGTAGAAAATGG + Intergenic
986749606 5:10775354-10775376 TTTTACTGCCTGCTAGGAAAAGG - Intergenic
988546238 5:32160703-32160725 ATTGGCTGCTAGGTAGAAAAAGG + Intronic
990670752 5:58127506-58127528 TGTCGCTGCCTGCCAGCAAACGG - Intergenic
991381491 5:66032630-66032652 TTTGGCTGCATGGTGGAAGATGG + Intronic
995300394 5:110574258-110574280 TTTCGCTTCTTGGTAGAAAATGG + Intronic
997351705 5:133235736-133235758 TTCCGCAGAATGGTAGAAAAGGG - Intronic
997727937 5:136137822-136137844 GTTCCCTGCTTAGTAGAAAAGGG - Intronic
999574280 5:152957456-152957478 TTCCCTTGCCAGGTAGAAAAAGG + Intergenic
1003500818 6:6701325-6701347 TTTAGCTGCCTGGAAGAGGAAGG + Intergenic
1010058218 6:71589727-71589749 TTTTGCTCCCTGGCAGCAAAAGG - Intergenic
1010287419 6:74095400-74095422 TTTCGGGACCTGGTAGAAATTGG - Intergenic
1011184039 6:84654506-84654528 TCTCACTGCCTTCTAGAAAATGG - Intergenic
1013346464 6:109265262-109265284 TGTTGCTTCCAGGTAGAAAAGGG + Intergenic
1015403549 6:132813491-132813513 TATTGCTTCCTGGAAGAAAATGG + Intergenic
1018583309 6:165327127-165327149 TTGTGCTGTCTGCTAGAAAATGG + Intergenic
1018603501 6:165573108-165573130 TATGGCTGCCTTGTTGAAAAGGG - Intronic
1020312913 7:6882844-6882866 TTAGACTGCCTGGTTGAAAATGG + Intergenic
1021924897 7:25524989-25525011 TTTCTCTGCTTACTAGAAAATGG + Intergenic
1028736332 7:94216958-94216980 TTCCACTGCCTGATAGAAGATGG + Intergenic
1029354938 7:100044822-100044844 TTCTGCTTCCTGGAAGAAAAAGG + Intergenic
1030335908 7:108325556-108325578 TTTGGCTGCCTTGTCCAAAAAGG + Intronic
1035868392 8:3109958-3109980 TTTTGCTACATGGTAGAAATAGG - Intronic
1037122559 8:15306335-15306357 TTTGGCTGCTTTGTGGAAAATGG - Intergenic
1037689234 8:21168837-21168859 TCTCCCTACCTGGGAGAAAAAGG - Intergenic
1038841699 8:31190273-31190295 TCTCGGTGGCTGGTAGAAACTGG - Intergenic
1040421210 8:47242110-47242132 TTTCTCTGCCTGGAATAAATAGG - Intergenic
1041461518 8:58116691-58116713 TTTCAGTGCCTGGGAGAAATAGG - Intronic
1044363413 8:91315033-91315055 TTGCCCTGCCTGGGAAAAAAAGG - Intronic
1046729668 8:117711586-117711608 TTTCTCCAGCTGGTAGAAAAAGG - Intergenic
1047897183 8:129379669-129379691 TTTCTCTGGCTGATAGCAAATGG + Intergenic
1050864468 9:10480292-10480314 CTCAGCTGCCTGGTAGAGAATGG - Intronic
1054893509 9:70280030-70280052 TTTCCCTGTCTGGTGGACAAAGG - Intronic
1055221902 9:73945296-73945318 TCTCCCTGCCTGATACAAAAGGG - Intergenic
1057250806 9:93500140-93500162 TTTGGCTGCTGGGAAGAAAATGG - Intronic
1059052983 9:110948556-110948578 TTTCTCAGCATGGTAGACAATGG - Intronic
1059523980 9:114972767-114972789 TTTCCATTCCTGTTAGAAAAGGG + Intergenic
1059790263 9:117635023-117635045 TTTGGCTGCATTGTAGAAAATGG - Intergenic
1062079761 9:134617623-134617645 TTTCTCTGACTGGTAGGGAAGGG + Intergenic
1187263335 X:17707613-17707635 TTTTTCTTCCTGATAGAAAATGG - Intronic
1188071136 X:25719726-25719748 TTTCCCTGGCTGGTTGCAAAAGG - Intergenic
1190050356 X:47144874-47144896 TTTCTCAGCCTGGCCGAAAATGG - Exonic
1194871329 X:99135966-99135988 TTTCTTTGCCTGATAGAATATGG + Intergenic
1195717018 X:107826937-107826959 GATCGCTCCCTGGCAGAAAAGGG - Intronic
1196527030 X:116739316-116739338 TTTGGTTCCTTGGTAGAAAAAGG - Intergenic