ID: 1174443502

View in Genome Browser
Species Human (GRCh38)
Location 20:50575010-50575032
Sequence GAGTCTGAAGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 6, 3: 100, 4: 902}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174443496_1174443502 17 Left 1174443496 20:50574970-50574992 CCAGTGAAGCATGCTGCCTTCTT 0: 2
1: 1
2: 6
3: 31
4: 243
Right 1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG 0: 1
1: 0
2: 6
3: 100
4: 902
1174443498_1174443502 1 Left 1174443498 20:50574986-50575008 CCTTCTTTGTGGTCCTCAGTCTT 0: 1
1: 0
2: 2
3: 38
4: 384
Right 1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG 0: 1
1: 0
2: 6
3: 100
4: 902
1174443494_1174443502 27 Left 1174443494 20:50574960-50574982 CCTGCAAGTCCCAGTGAAGCATG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG 0: 1
1: 0
2: 6
3: 100
4: 902
1174443495_1174443502 18 Left 1174443495 20:50574969-50574991 CCCAGTGAAGCATGCTGCCTTCT 0: 1
1: 1
2: 2
3: 27
4: 202
Right 1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG 0: 1
1: 0
2: 6
3: 100
4: 902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174443502 Original CRISPR GAGTCTGAAGAGAGGGAAGA AGG Intronic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900504155 1:3020938-3020960 GAGTCTGCAGAGAGGAATGAGGG + Intergenic
901337501 1:8463768-8463790 GAGACTGAAGAGAGAGGAGATGG + Intronic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
902931641 1:19735577-19735599 GAAACTGGAAAGAGGGAAGAGGG - Intronic
902969991 1:20041366-20041388 GAGTCTGAAAAGAGAGTAAAGGG + Intronic
903192868 1:21666595-21666617 GAATCAGAAAAGAGGGAGGAAGG + Intronic
903345680 1:22682654-22682676 GAGTCTTAAGAGTGGGAGGGAGG - Intergenic
903451533 1:23456826-23456848 GAGTCTGGGGAGATGGCAGAGGG + Intronic
903587412 1:24426748-24426770 GAGGTGGAAGAGAGGGGAGAAGG - Intronic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904386885 1:30148705-30148727 GGGGCAGAAGACAGGGAAGAGGG + Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904696045 1:32332134-32332156 GATTCTGAAGAGGAGGGAGAGGG + Exonic
904876158 1:33656105-33656127 GAGTCTGAAGACTTGAAAGAAGG + Intronic
904973034 1:34433984-34434006 GAGACAGAGGAGAGGGTAGAGGG + Intergenic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905184700 1:36188012-36188034 GAGCCTGAAGAGAGCGGAGGTGG + Intergenic
905303931 1:37004826-37004848 CGGTCTCAAGAGTGGGAAGAGGG - Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905790157 1:40785189-40785211 GAGCCTGGTGAGAGGGAGGAGGG - Intronic
906013111 1:42548108-42548130 GAGTGTGAAGAGAGGAAATGGGG + Intronic
906276134 1:44517339-44517361 GAGGCTGGAGAGAGGGAACTGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908066024 1:60405441-60405463 GACTCTGAAGGGTGGGAAGGTGG + Intergenic
908329899 1:63061252-63061274 GAGTCTGAAGACTGAGAAGCAGG + Intergenic
908362221 1:63380372-63380394 GTGGCTGAAGTGGGGGAAGAAGG + Intronic
908433598 1:64082790-64082812 GAGAAAGAAGAGTGGGAAGAAGG - Intronic
908756653 1:67474739-67474761 GAGGTTGCAGAGAGGCAAGATGG + Intergenic
909095523 1:71283027-71283049 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
909198506 1:72658327-72658349 GACTCTGAGGAGTAGGAAGAGGG - Intergenic
909379655 1:74984012-74984034 GAGGTAGTAGAGAGGGAAGATGG - Intergenic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909639913 1:77861568-77861590 GAGAAGGAAGAGAGGGAACAAGG - Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910355977 1:86355673-86355695 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
910563399 1:88617328-88617350 GGGGCTGAGGAGAGGGGAGATGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911538152 1:99125241-99125263 GAGATTGAAGGGTGGGAAGAGGG - Intergenic
911548589 1:99252089-99252111 GAGGGTGAAGGGTGGGAAGAGGG + Intergenic
911570872 1:99515261-99515283 GAGTCTGAAGAGAGTCAGGAAGG - Intergenic
911604517 1:99888030-99888052 GAATCAGAAGAAAAGGAAGATGG + Exonic
911667853 1:100574381-100574403 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
911795824 1:102074952-102074974 GAATCTGTAGAGATGGAGGATGG - Intergenic
912151882 1:106869635-106869657 GAGGGTGAAGAATGGGAAGAGGG - Intergenic
912178184 1:107186025-107186047 GACTCTGAAGAGTGGGAGGGTGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912887838 1:113494355-113494377 GAGGATGAAGGGTGGGAAGAGGG + Intronic
912935279 1:113998522-113998544 GAGTCTGAAGAGAGAAGAGCAGG + Intergenic
913199594 1:116485040-116485062 GAGTCAGCAGAGAAGGAAGGCGG + Intergenic
913360348 1:117973823-117973845 GACTCTGAAAGGAGGGAGGAAGG - Intronic
914320238 1:146552094-146552116 GAGACTGGAGAGTAGGAAGAAGG + Intergenic
914936778 1:151988703-151988725 GTGTCAGAAGAGAAGGAAAAGGG - Intronic
915090923 1:153425343-153425365 GATTCTGATAAGAGGGTAGATGG + Intergenic
915204915 1:154262978-154263000 AATTCTGAAGGGAGGCAAGAAGG - Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915917585 1:159950288-159950310 GTGTCTGAAGGGTGGGGAGAGGG - Intergenic
915945667 1:160149753-160149775 GAGTTTGGAGGGAGGGAAGGTGG + Intergenic
915945909 1:160151776-160151798 GAGTCAGGAGTGAGGGAAGAGGG - Exonic
916077901 1:161213361-161213383 AAGTCTGAAGAGAGGAAACAGGG - Exonic
916108008 1:161444667-161444689 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916109594 1:161452047-161452069 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916111178 1:161459456-161459478 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916112767 1:161466838-161466860 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916188351 1:162154689-162154711 AGGTCACAAGAGAGGGAAGATGG - Intronic
916807610 1:168274193-168274215 GAGGCTGGAGGGTGGGAAGAGGG - Intergenic
917044060 1:170837032-170837054 GTGTGTGAAGAGAGAGAAAAAGG + Intergenic
917149229 1:171927389-171927411 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
917574303 1:176304802-176304824 AACTCAGAAGAGAGGGAAAATGG + Intergenic
917895236 1:179480728-179480750 GAGTCTTAATACAAGGAAGAGGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918526422 1:185469582-185469604 GAGCATGAAGATAAGGAAGAAGG + Intergenic
918703557 1:187635318-187635340 GAGACTGGAGAGAGTGTAGAAGG + Intergenic
918910444 1:190561424-190561446 GGGCCAGAATAGAGGGAAGAAGG - Intergenic
919138197 1:193537011-193537033 AACTCTGAAGAGAGGGACAAAGG + Intergenic
919467370 1:197938641-197938663 AAGGCTGCAGAGAGTGAAGATGG - Intergenic
919482268 1:198105183-198105205 GAGTTTGATGAGAGGAAAAAAGG - Intergenic
920044677 1:203125717-203125739 GAGTCAGAAGAGCTGGAAGCTGG - Intronic
920242436 1:204562757-204562779 GAGTTTGAAGAGAGTGGAGCAGG + Intergenic
921152143 1:212411281-212411303 GAGTCTGCTGAGAGAAAAGAGGG + Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921411092 1:214836861-214836883 GAACCTGCAGAAAGGGAAGAAGG + Intergenic
921427881 1:215025416-215025438 GAGAATGAAGACAGGGAATAGGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921501733 1:215912798-215912820 GAGGGTGAAGGGTGGGAAGATGG - Intronic
921919726 1:220654068-220654090 GAATCTAAAGATAGGTAAGATGG + Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922207148 1:223458042-223458064 GAGTGTGGAGAGTGGGAGGAGGG - Intergenic
922404067 1:225293663-225293685 GAGTGTGAAGGGTGGGAGGAGGG + Intronic
922529398 1:226331904-226331926 GAGGCTGCAGAGAGCCAAGAGGG + Intergenic
922556145 1:226533796-226533818 AAGTCAGAAGAGAGGGATGAAGG - Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923446998 1:234081109-234081131 AAGACTGAAGAGACTGAAGAAGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923549733 1:234954032-234954054 GAGTCAGAAAGGAGGGAAGGAGG + Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
1063688607 10:8262065-8262087 GAGACAGAAGAGAGAGAAGAGGG + Intergenic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1064497778 10:15932135-15932157 GAGACTGGAGGGTGGGAAGAGGG - Intergenic
1064906024 10:20347021-20347043 GACTCTGAAAGGTGGGAAGAGGG - Intergenic
1065822998 10:29543660-29543682 GAGGAGGAAGAGAGGTAAGAAGG - Intronic
1065866426 10:29919080-29919102 GAGGCAGAAGAGAGGGGAGGAGG - Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066096569 10:32077876-32077898 TAGTATGAAAAGTGGGAAGAGGG + Intergenic
1066269301 10:33806805-33806827 GAGTCTGAAGAGAAACAAAATGG - Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067317621 10:45182921-45182943 GAGTCTGCAGTGAGCCAAGATGG + Intergenic
1067436378 10:46282184-46282206 AAGTCTGATGAGGGGGAAGTTGG - Intergenic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069735889 10:70653977-70653999 GAGTCCTAAGAGAAGGAAGGAGG + Intergenic
1069980343 10:72248071-72248093 GGGTCTGAAGAGAGTGAACAAGG - Intergenic
1070746410 10:78936447-78936469 GCTTCTGCAGAGAGGGGAGAAGG + Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071515243 10:86292610-86292632 GGCCCTGAAGAGAGGGAGGAAGG - Intronic
1072004657 10:91232816-91232838 GGGTTTGAAGAGAGAGGAGAAGG + Intronic
1072136498 10:92551693-92551715 GGGTCTGAAGGGAGGGGAAATGG + Intronic
1072267089 10:93741259-93741281 GGGTCTCAAGAAAGGGAAAATGG - Intergenic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1073158761 10:101371251-101371273 GAGTCTGCAGTGAGCCAAGATGG - Intronic
1073310342 10:102535625-102535647 GTATCAGAAGAAAGGGAAGAGGG - Intronic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1073404239 10:103283259-103283281 GAGTCTAGAGTGAGGGAAAAAGG - Intronic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1073915019 10:108392660-108392682 TAGGCTGAAGAGAGGGACAAGGG + Intergenic
1074064182 10:109998151-109998173 TACTCTGAAGAGAAGAAAGAGGG + Intronic
1074125243 10:110523974-110523996 GATTCTGCAGAGGAGGAAGAAGG + Intergenic
1074549471 10:114429290-114429312 GAGGCTGAAGAGAGGCTAAACGG + Intergenic
1074865125 10:117540449-117540471 GAGCCTGAAGACATGGCAGAGGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075417064 10:122271979-122272001 GAATCTGAGAAGAGAGAAGAGGG - Intronic
1075726607 10:124613762-124613784 GAGTCTGAAGAGGAGGCAGTGGG - Exonic
1076345583 10:129776767-129776789 GACTCCAAAGGGAGGGAAGAGGG - Intergenic
1077284034 11:1758018-1758040 GAGGCTGCAGAGAGAGAACACGG + Intronic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1077864660 11:6212116-6212138 GAGGCTGGATAGAGGGAAAAAGG - Intronic
1078000400 11:7490171-7490193 GAGTCAGAAGAAAGAGAGGAGGG + Intronic
1078018406 11:7635035-7635057 GAGTCTGGAAAGATGGAGGAGGG + Intronic
1078314797 11:10285333-10285355 GAGAAGGAAGAGAGGGGAGAGGG + Intronic
1079186217 11:18239771-18239793 GAGACTGAAGAGAGGTCTGAAGG - Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079966683 11:26988632-26988654 GAATCTGAAGGAAGGGAAGGAGG - Intergenic
1080000752 11:27346404-27346426 GAGACAGAAGAGAGGGAAACAGG + Intronic
1080023600 11:27590664-27590686 GAGTATGAAGATAGGGAAATGGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080497823 11:32837896-32837918 GACTCTTAAGAAAGGGAAAAAGG - Intronic
1080539005 11:33248784-33248806 GAATATAAAGAGAGGGAAGAAGG + Intergenic
1080932547 11:36827163-36827185 GAGACTGAAGGGAGGGAAAATGG - Intergenic
1081060382 11:38467612-38467634 GAGTGTGGAGAGTGGGAGGAGGG + Intergenic
1081230137 11:40576150-40576172 AGGTCTGTAGAGAGGGATGAAGG + Intronic
1081674446 11:44960412-44960434 GAGGCAGGAGAGAGGGAAGTAGG - Intergenic
1081809409 11:45906687-45906709 TAGTCTAAAGAGAGAAAAGAGGG + Exonic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1083068658 11:59952626-59952648 GACTCAGAAGAGGGGGAAGTTGG + Intergenic
1083137037 11:60688772-60688794 GAGCCTGCAGAGAGGGACCATGG + Intergenic
1083545500 11:63546044-63546066 GAGGCAGGAGAGAGGGGAGAGGG + Intronic
1083546973 11:63556199-63556221 GAGTCAGATGAGAAGGAAGGAGG + Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1084364028 11:68686021-68686043 GAGCTTGGAGAAAGGGAAGAGGG - Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084472143 11:69368780-69368802 GAGACTGGGGAGGGGGAAGAGGG - Intergenic
1084902347 11:72319014-72319036 GAGCCTGAAGGGATGGAAGCTGG + Intronic
1085053682 11:73392343-73392365 GAGGCAGAAGACAGGGACGATGG - Exonic
1085350457 11:75795037-75795059 GAGTGAGAAGAAAGGAAAGAAGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086102330 11:83114111-83114133 GAGGCTGAAGCGAGGGCAGATGG - Intergenic
1086340236 11:85841669-85841691 GAGTATGGAGGGTGGGAAGAGGG + Intergenic
1086585407 11:88445674-88445696 GAGAGTGAAGGGTGGGAAGAGGG - Intergenic
1086739837 11:90353226-90353248 GAGCCTGATGAGAGCGGAGAGGG + Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087628829 11:100626695-100626717 GAGTGTGAAAGGAGGGAACAAGG + Intergenic
1088184099 11:107144237-107144259 GAGACTGTAGAGGGGGAGGAAGG - Intergenic
1088435763 11:109811503-109811525 GAATAGGAAGAGAGAGAAGAAGG + Intergenic
1089482253 11:118815591-118815613 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1090834826 11:130446778-130446800 GATTCTGCGGAGAGGTAAGAAGG + Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090915961 11:131162180-131162202 GTGACTGGAGAGAGAGAAGAAGG - Intergenic
1091721015 12:2813696-2813718 GAGTAGGAAGATAGGGCAGAGGG - Intronic
1091752213 12:3030080-3030102 TATTCAAAAGAGAGGGAAGAGGG - Intronic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1092929265 12:13299889-13299911 GAGACAGATGAGAGAGAAGAGGG - Intergenic
1092936970 12:13373284-13373306 GAGGCTGAAGAGTGGACAGACGG - Exonic
1093019641 12:14191462-14191484 GAGTTTGGAGGGAGGGAGGAGGG + Intergenic
1093839225 12:23875578-23875600 GAGGAGGAAGAGAGGAAAGAAGG + Intronic
1093877216 12:24363205-24363227 GAGTCTGGTGAGAGAGAAAAGGG - Intergenic
1093990934 12:25589779-25589801 TAGGCTGAAGAGAGTGTAGATGG + Intronic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1095044736 12:37489506-37489528 GTGGCAGAAGAGAGGGAAGTAGG - Intergenic
1095578194 12:43763705-43763727 GAGTATGAGGGGAGGGAAAATGG - Intronic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095984701 12:47991541-47991563 GAGTCTGATGGGAGGGGAGAGGG + Intronic
1096080995 12:48832413-48832435 GAGTCAGAAAAGAGGTATGAGGG - Exonic
1096635977 12:52959889-52959911 AAGTCAGGAGAGAGGGAAGTGGG - Intergenic
1096846168 12:54408243-54408265 GAGTATGAAGAGGGAGTAGATGG + Intronic
1097008508 12:55936033-55936055 GAGTCTGCAGAGATTGACGATGG + Intronic
1097756015 12:63407472-63407494 TAGTTTGAAGTGAGGGAATAGGG + Intergenic
1098841939 12:75487707-75487729 GAGTAGGAAGTGAGGCAAGAGGG - Intronic
1099098890 12:78411825-78411847 GAGACTGGAGTGTGGGAAGAGGG + Intergenic
1099324527 12:81197480-81197502 AGGTCTGAAGAGTGGGGAGAGGG - Intronic
1100353694 12:93808977-93808999 GAGGCTGAAGTGAGCCAAGAAGG - Intronic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100580876 12:95939395-95939417 GAGACTGTAGAAAGGGAAAAGGG + Intronic
1100783526 12:98054960-98054982 GTGACTGGAGAGAGGCAAGAAGG - Intergenic
1100800227 12:98223072-98223094 GAGTCTGAAGAGAAAGACAATGG - Intergenic
1101408896 12:104453226-104453248 GAGGAAGGAGAGAGGGAAGAAGG - Intergenic
1102061910 12:109939049-109939071 GAGTCTGAAAATAGAGAAAAGGG + Intronic
1102097236 12:110250391-110250413 GAGACAGGAGAGAGGGAAGGTGG - Intergenic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1103080161 12:118017218-118017240 GGTTTTGAAGAGTGGGAAGAGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1104201706 12:126596008-126596030 GAGGCTGCAGAGAGCCAAGATGG + Intergenic
1104253215 12:127116447-127116469 GAGACTGAAGGAAGGCAAGAGGG + Intergenic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1104989009 12:132614373-132614395 GAGGCTGCAGAGAGGGTAAAAGG + Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105246755 13:18659756-18659778 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1106598617 13:31168680-31168702 GTCTCTGAAAAGAGGGAACAGGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106655642 13:31743588-31743610 GAGTCAGAACAGTGGGAAGGGGG - Intronic
1106970388 13:35133846-35133868 GAGTGTGAAGAATGGGATGATGG + Intronic
1107061374 13:36163055-36163077 TAGGCTGCAGAGAGGGAAGGTGG + Intergenic
1107460899 13:40601110-40601132 TAGTCTGATGAAAGGGAAGATGG - Intronic
1107542347 13:41403046-41403068 GACTGTGAAGAGAAGGAAGCTGG - Intergenic
1107718599 13:43225261-43225283 GAGGCGGGAGAGAGGGATGAGGG + Intronic
1107877804 13:44806047-44806069 GAGTCTGCAGAGAGCTATGATGG - Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108387763 13:49916909-49916931 GGACCTGAAGAGAGGGAAGCTGG + Intronic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109204303 13:59464936-59464958 AAGTCTGTGGACAGGGAAGAGGG + Intergenic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1109295284 13:60523639-60523661 GAGGCTGCAGTGAGGGAAGATGG - Intronic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1110160285 13:72368927-72368949 AATTCTGAAGACAGGAAAGATGG - Intergenic
1110586115 13:77195530-77195552 GAGGCTGCAGAGAGCCAAGATGG + Intronic
1110643933 13:77859270-77859292 GAGACTGGAGAAATGGAAGAAGG - Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1111374391 13:87358550-87358572 GATTCTGAAGAGAGCAAAAAGGG + Intergenic
1111435143 13:88196829-88196851 GAGGTTGAAGAGTGGGAGGAGGG - Intergenic
1111665377 13:91261221-91261243 GAGACTGAAGAGTGAGAGGAAGG + Intergenic
1111768082 13:92559911-92559933 GTGCCTGAAGAGAGGGGACAGGG - Intronic
1111873716 13:93866718-93866740 GAGTGTGAAGAGTGGGAGTAGGG + Intronic
1112539675 13:100296303-100296325 GAGGCTGCAGTGAGGCAAGATGG - Intronic
1112949742 13:104977981-104978003 GACTGGGAAGAGAGGGAAAAAGG - Intergenic
1113032758 13:106012904-106012926 GAGTCTGGAGATAGAAAAGATGG - Intergenic
1113224755 13:108147454-108147476 GTGGCTGAATAGATGGAAGATGG - Intergenic
1113320860 13:109230649-109230671 AAGGCTGAAGAGAGGGAAATGGG + Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113574105 13:111382281-111382303 GGGTCTGTAGAGATGGTAGAGGG + Intergenic
1113766070 13:112881857-112881879 GGCTCTGCAGAGAGGCAAGAGGG - Exonic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1114552339 14:23540050-23540072 GAGTCTGCAGTGAGACAAGATGG - Intronic
1114649556 14:24275631-24275653 GAGTCTGGAGGGAGGAAAGGGGG + Intergenic
1114663982 14:24368014-24368036 GGGACTGAAGAGAGGACAGAGGG + Intronic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115454403 14:33584961-33584983 GAATGTGAAGTGTGGGAAGAAGG + Intronic
1115581339 14:34761863-34761885 GACTCTGAAGTTAGGGAAGTTGG + Exonic
1115890415 14:38020628-38020650 GAGAATGAAGAAAGGAAAGAGGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116005525 14:39286426-39286448 GAGACTGTGGAGAGGGGAGAGGG + Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116701883 14:48255283-48255305 GAGTCTGAAAAGAGAGCAAAGGG + Intergenic
1117402040 14:55367346-55367368 GAGTTCGTAGAGAGTGAAGATGG - Exonic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118108056 14:62682985-62683007 CTATCTGAAGAGACGGAAGATGG + Intergenic
1118269911 14:64333302-64333324 GAGTCTTAAAAGAGGCAAGCAGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1118495543 14:66305037-66305059 GCATCTCAAGAGTGGGAAGAAGG + Intergenic
1118822152 14:69352614-69352636 GAGGCTGAAGGCTGGGAAGAGGG + Intronic
1118916935 14:70115592-70115614 GTGCCTGAGGAGAGGGACGATGG + Intronic
1120033840 14:79673123-79673145 CAGGCTGAAGAGAGGGGAAAGGG + Intronic
1120111085 14:80557752-80557774 GAGTATGAAGAGAGGAAAGATGG - Intronic
1120117611 14:80638155-80638177 AAATATGAAGAGAAGGAAGAAGG - Intronic
1120325220 14:83015384-83015406 GAGGCTGGAGAGATGGAAAAGGG - Intergenic
1120694329 14:87627590-87627612 GAGTCTGGAGAGTAGGAAGCAGG - Intergenic
1120738170 14:88078598-88078620 AGGGCAGAAGAGAGGGAAGAAGG - Intergenic
1120796746 14:88641783-88641805 GTGTCTAGAGAGAGGGCAGATGG - Intronic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121489091 14:94345049-94345071 GGGGCTGGGGAGAGGGAAGATGG + Intergenic
1121567146 14:94918659-94918681 TAGTCTGAAGAGAGGAGAGGAGG + Intergenic
1121924901 14:97918455-97918477 AAGACTGAAGAAAGGGAATAGGG + Intergenic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1124025987 15:25966383-25966405 GAGTCTGTGGAGAGAGAAGGAGG - Intergenic
1124615548 15:31239179-31239201 GTGACTGAAGACAGGGAAGTGGG + Intergenic
1124891189 15:33734752-33734774 GAGTTTGCAGAGAGTGGAGATGG - Intronic
1124918454 15:33999543-33999565 GGGTCTGAACAGTGAGAAGAAGG - Intronic
1125637718 15:41203413-41203435 GAGTCTCAACAAAGGGAAGAGGG - Intronic
1125719830 15:41840025-41840047 GATTCTGATGAGATGGAGGATGG + Intronic
1125769625 15:42156462-42156484 GCTTCAGAAGAGAGAGAAGAGGG - Exonic
1125896508 15:43307290-43307312 GAGTTTGAAGAGGGGGCAGAAGG - Intergenic
1126442502 15:48705106-48705128 GAGGGTGAAGAGTGGGAAAAGGG + Intergenic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126778656 15:52119925-52119947 GAGGTAGAAGAGCGGGAAGAGGG + Exonic
1126907542 15:53384197-53384219 GAGGTTGAAGAGAGGAAAGAAGG - Intergenic
1127758085 15:62112449-62112471 GACTGAGAAGAAAGGGAAGAGGG + Intergenic
1127998470 15:64169535-64169557 GCCTCTCAAGAGAGGGCAGAGGG - Exonic
1129153057 15:73701164-73701186 GAGTCAGAAGTGAGGGGAAAAGG - Intronic
1129324538 15:74793262-74793284 GGGTCTGGAAACAGGGAAGAGGG - Intronic
1129438703 15:75563076-75563098 GAGTGTGGAGAGTGGGAGGAGGG - Intronic
1129718812 15:77866676-77866698 GAGTCAGGAGAGAGGGGAGGTGG - Intergenic
1129878384 15:78991927-78991949 GAATCTGATGAGAGGGTGGATGG + Intronic
1131035439 15:89218908-89218930 GAGAGAGAAGAGAGGGAAGGTGG + Intronic
1131254430 15:90852721-90852743 GGCTTTGAAGAGAGGCAAGAAGG - Intergenic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131515625 15:93074378-93074400 AAGTTTGAAGGGAGGGGAGAAGG + Intronic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1131890812 15:96969714-96969736 GAGCCTGCAGAGGCGGAAGAAGG - Intergenic
1131898680 15:97063415-97063437 AAGGCTGGAGAGAGGTAAGAAGG + Intergenic
1132020413 15:98356541-98356563 GAGCGGGAAGAGAGGGAGGAAGG + Intergenic
1132250474 15:100332278-100332300 GAAACTGAAGAAATGGAAGACGG + Intronic
1132339931 15:101071865-101071887 GAGACTGAGGAATGGGAAGAAGG + Intronic
1132491055 16:231182-231204 GCGTCTGAAGAGGAGGGAGAAGG - Intergenic
1133397745 16:5461883-5461905 GAGTCTAAAGAGAAGGGACAAGG + Intergenic
1134064522 16:11219220-11219242 GAGGCTGAAGAGTGAGAGGAAGG - Intergenic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1135987745 16:27196510-27196532 GAGTCTGCAGTGAGCGGAGATGG - Intergenic
1136045904 16:27614777-27614799 GGGTCTAGAGAGAGGGAAGTCGG + Intronic
1136401715 16:30022894-30022916 GAGGCTGTAGAGAGCCAAGATGG + Intronic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138130636 16:54476763-54476785 GAGACTGAATAGAGGAATGATGG + Intergenic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1138219710 16:55240351-55240373 GGGTCAAAAGAGAGGGGAGAAGG - Intergenic
1138219714 16:55240371-55240393 GGGGTTGAAGAGAGGAAAGAGGG - Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138755297 16:59476693-59476715 GAGTCAGAAGGGTGGGAGGAGGG + Intergenic
1138880029 16:61001858-61001880 GAGGCTGTAGTGAGTGAAGATGG + Intergenic
1138948576 16:61882721-61882743 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
1139028021 16:62843348-62843370 GAGTCTGATGAGTAGGAAGTGGG + Intergenic
1139432755 16:66919846-66919868 GAGTCTGGAATGAGGGGAGAGGG + Intergenic
1139518489 16:67465825-67465847 GAGACTTAAGTGAGGGAAGTAGG + Intronic
1139529641 16:67536841-67536863 GGGGCTGAAGAGTGGAAAGATGG - Intronic
1139707388 16:68750767-68750789 GAGGCTGAAGTGAGCCAAGATGG - Intronic
1140013295 16:71158012-71158034 GAGACTGGAGAGTAGGAAGAAGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140170383 16:72598612-72598634 GACTCTGGAGAGTGGGAGGAGGG + Intergenic
1140214852 16:72999212-72999234 GAGGTTGCAGTGAGGGAAGATGG - Intronic
1140416692 16:74778682-74778704 CAGTCCGAAGAGAAGGGAGAGGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1140593268 16:76378121-76378143 GATTCTAAAAAGAGGGAGGATGG + Intronic
1140656474 16:77145479-77145501 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1140770536 16:78199791-78199813 GATTCTGACAAGAGAGAAGAGGG - Intronic
1140943610 16:79747108-79747130 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1140960297 16:79905475-79905497 GAGTCAGAAGGGAAGGAAAAAGG - Intergenic
1141476750 16:84279231-84279253 GAGTCTGAAGGGGAGGAAGAGGG + Intergenic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1143197167 17:5084739-5084761 GTTTCTGAAGAGAGATAAGATGG - Intronic
1143345372 17:6245218-6245240 GACTCTGAAGACAGTGGAGAGGG - Intergenic
1143515122 17:7415650-7415672 GACTCTGCAGAGAGCGAGGACGG + Exonic
1143590114 17:7880200-7880222 CAGACAGAAGAGAGGGGAGAGGG + Intronic
1143799724 17:9368598-9368620 GAGTCTGAAGAGAGGTGTGGAGG - Intronic
1143974547 17:10820379-10820401 GAGTCTGCAGTGAGCCAAGATGG - Intergenic
1144044413 17:11442082-11442104 GAGGCTGATGACAGTGAAGAAGG - Intronic
1144319529 17:14100776-14100798 CACTCTGAAGAGAAGCAAGATGG + Intronic
1145873294 17:28294576-28294598 GAATCTGCAGAGAGGAAAGGAGG - Intergenic
1145980696 17:29009707-29009729 GAGACCAGAGAGAGGGAAGAAGG + Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146545286 17:33733151-33733173 GAGTCAGAAGTGAGGGGACAGGG - Intronic
1146552836 17:33796740-33796762 AAGTATGAAGTGAGGGAAAAAGG + Intronic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1146957732 17:36946542-36946564 GCATCTGAAGAGAGGCAAGTGGG + Intergenic
1147256725 17:39186115-39186137 GAGTCAGGAGAGAGGGAGGAGGG + Intronic
1147260746 17:39208686-39208708 GAGTCTGGAGAGATGGATGCTGG - Intergenic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147685240 17:42283301-42283323 GAGCCTGGAGAGAGGAGAGAGGG - Intergenic
1147789223 17:43002770-43002792 AAGTTTGAAGAGAGGTAAGTAGG + Exonic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148778462 17:50108919-50108941 GCTACAGAAGAGAGGGAAGATGG - Intronic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1149052967 17:52328792-52328814 GAGGAAGAAGAGGGGGAAGAGGG - Intergenic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1150118603 17:62578895-62578917 GAGCCTTAAGAAAGGGAAGATGG + Intronic
1150288244 17:63966138-63966160 GAGGCGGAAGAGAGCCAAGAAGG + Exonic
1150521933 17:65877523-65877545 GAGTCTGAAGTGAGGGAATGAGG - Intronic
1151409538 17:73912690-73912712 GACTCTGAAGACAGGAAGGAAGG - Intergenic
1151531963 17:74712403-74712425 GACTTTGAAAGGAGGGAAGAGGG - Intronic
1152496637 17:80677515-80677537 GAGTCTGGTGGGAGGGAAGGTGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1153434781 18:5057827-5057849 GAGTCTCAAGAGAGGTTAGTGGG - Intergenic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1153536200 18:6104564-6104586 GAGGCTGCAGGGAGGGAAAATGG + Intronic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1154442102 18:14399366-14399388 GAGTCAGAGTAGAGTGAAGAAGG + Intergenic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155463227 18:26107076-26107098 GAGTATGAAAAGTGGGAGGAGGG - Intergenic
1155536663 18:26825577-26825599 GGGTCTGCAGACAGGGAAGTCGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155657249 18:28206609-28206631 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1155743826 18:29324846-29324868 GAGTTTGAAAAGTGGGAAAATGG - Intergenic
1155753117 18:29454195-29454217 AAAACTGAGGAGAGGGAAGAAGG + Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1156623540 18:38881715-38881737 GAGGCAGAAGAGAGGGAATAGGG + Intergenic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157572614 18:48723147-48723169 GAGTCTGCAGATGGGGAAGGAGG - Intronic
1158813957 18:61071959-61071981 GAGGATGAAGTGTGGGAAGAGGG + Intergenic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159873509 18:73785276-73785298 GAGTTTGAAGTGATGAAAGATGG + Intergenic
1159945439 18:74441344-74441366 GAGCCTCAAGTGAGGGCAGAAGG + Intronic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1160293531 18:77617097-77617119 CACTCTGAAAAGTGGGAAGAAGG - Intergenic
1160475116 18:79177182-79177204 GAGGCGGAAGAGGGGGAAGGGGG - Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162603101 19:11684893-11684915 GAGTCTGAAGGTAAGGAAGATGG + Intergenic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1164292430 19:23880275-23880297 GAGGCAGAGGAGGGGGAAGAAGG + Intergenic
1164453836 19:28390544-28390566 GAGTCTGAGGAGCTGAAAGAAGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164894713 19:31863072-31863094 GATAATGAAGAGAGGAAAGAGGG + Intergenic
1165658539 19:37554659-37554681 GAGTCTGAGAAGCGGGGAGAAGG - Intronic
1166052741 19:40270093-40270115 GAGGCTGAAGAGAGTGGAGAGGG - Intronic
1167379500 19:49130359-49130381 GAGTCTGGAGTGAGGGAAGGAGG - Exonic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1168013109 19:53549785-53549807 GAGTCTAAAGATAGGAAGGAAGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925326212 2:3023929-3023951 GAAGATGGAGAGAGGGAAGATGG + Intergenic
925466137 2:4108698-4108720 GAGCCTTGAGAGCGGGAAGAGGG - Intergenic
925497538 2:4469111-4469133 GCGTCTGAAGATGGGGAGGAAGG - Intergenic
925808075 2:7672147-7672169 GATCCTGAAGGGACGGAAGAAGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926367310 2:12145114-12145136 GAGTCAGTAGAGATGGAAGAAGG + Intergenic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926765422 2:16319331-16319353 GTTTCCGAAGAGAGGGGAGATGG - Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
927121022 2:19963510-19963532 GAGTCAGATGAGAGGTCAGAAGG - Intronic
927269900 2:21195433-21195455 AAATCTGAAGAAAGGGAAGAAGG - Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
927653909 2:24929386-24929408 GAGACAGGAGAGAGGGAAGATGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928015559 2:27653675-27653697 GAGCCTCAAGAAAGTGAAGAAGG - Exonic
928017882 2:27675629-27675651 GCGTCTGAACAGAATGAAGAAGG + Exonic
928178552 2:29051684-29051706 GTGTCCCAAGAGAGGGAAGTGGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928955403 2:36861916-36861938 GACTGTGAAGGGTGGGAAGAGGG - Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929166591 2:38887859-38887881 GAGTCTGCAGTGAGCCAAGATGG + Intronic
929465814 2:42142859-42142881 GAGCCTGCAGCGAGGCAAGATGG - Intergenic
929782800 2:44968155-44968177 GAGTTTGGAGAGAGGGTAGGTGG + Intergenic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
929862313 2:45689947-45689969 TAGTCTCTAGAGAGGGAAGTGGG - Intronic
930680882 2:54255718-54255740 GAGTCTGAAGTGATTGCAGAGGG - Exonic
930681390 2:54260299-54260321 GAGTCTGAGGACAGAGAAGAAGG + Intronic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931944664 2:67292298-67292320 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932659646 2:73641270-73641292 GAGTCTGAAGAGAAGGTGGTGGG - Exonic
933554664 2:83817204-83817226 GAGGTTGAAGAGTGGGAAAAGGG - Intergenic
934047335 2:88183604-88183626 GAGGAAGGAGAGAGGGAAGAAGG - Intronic
934669700 2:96203276-96203298 GAGACTTAAGAGAGGACAGAAGG + Intronic
934959333 2:98655152-98655174 GACAGTGGAGAGAGGGAAGAGGG + Intronic
935037324 2:99391267-99391289 GAGTAAGCTGAGAGGGAAGAAGG + Intronic
935050296 2:99519298-99519320 GAGTTTGCAGTGAGGCAAGATGG + Intergenic
936605254 2:113945785-113945807 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937350918 2:121160823-121160845 GAGGCGGAGGAGAAGGAAGAAGG - Intergenic
937481767 2:122268993-122269015 TAGTCTGGAGAGAGGGTGGAAGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937777748 2:125800220-125800242 GAGTATGTTGAGAAGGAAGAGGG - Intergenic
938395620 2:130945536-130945558 AGATCTGAAGAGAGGGAAAAGGG - Intronic
938555674 2:132421827-132421849 GAGAGAGAAGAGAGGGTAGAGGG + Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939175630 2:138744641-138744663 GAGGCTCAAGAAAAGGAAGAAGG - Intronic
939514029 2:143143907-143143929 GAGTTTGGAGGGTGGGAAGAGGG - Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
940192342 2:151055240-151055262 GAGTCTGTAGTGAGGTATGATGG - Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
940697095 2:156993415-156993437 GAGTGTGTAGAGTGAGAAGAAGG + Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941641664 2:167995601-167995623 GAGTATCAAGAGAGAGAAGATGG + Intronic
941698423 2:168577772-168577794 GCATCTGAGGAGAGTGAAGAGGG + Intronic
942134010 2:172907337-172907359 GGCTCAGAATAGAGGGAAGAGGG - Intronic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943723860 2:191232929-191232951 AAGACTGGAGAGTGGGAAGAGGG + Intergenic
943733709 2:191330736-191330758 GAGTCTGTGGAGGAGGAAGATGG + Intronic
943758410 2:191583221-191583243 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
944022960 2:195127097-195127119 GAATCTGAAGTGAGAGATGAGGG + Intergenic
944235240 2:197436290-197436312 GAGTCTGGTGAGAGGGAAAGAGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944825314 2:203477559-203477581 TCATATGAAGAGAGGGAAGAGGG - Intronic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
945071340 2:205991926-205991948 GAGGCTGAAGTGAGCCAAGATGG + Intergenic
945096944 2:206229260-206229282 GATTCTATAGAGAGGGAAGGGGG + Intergenic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945571903 2:211478739-211478761 GAGTTAGAAAAGAGGTAAGATGG - Intronic
945854271 2:215049002-215049024 GAGTGTGAAGTGTGGGAGGAGGG + Intronic
945946801 2:216002680-216002702 AGGTCTCAATAGAGGGAAGAAGG - Intronic
946241384 2:218357967-218357989 GAGGCTGAAGGAAGGGAAGGTGG - Intronic
946403119 2:219479193-219479215 GAGTCTGAGGTGAGGGCAGTGGG + Exonic
946662340 2:222015016-222015038 GTGTCTGAAGGGAAGGAAGTGGG - Intergenic
947049950 2:226031083-226031105 GATTCTGCAGAGAGGGGAGGAGG - Intergenic
947539852 2:230968920-230968942 GAGTCGCAAGAGGGAGAAGATGG + Intergenic
947544693 2:231002554-231002576 GAGTTTGGAGAGGGGGAAGATGG + Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948690909 2:239704572-239704594 GTGTCTGGAGAGATGAAAGAGGG + Intergenic
948754774 2:240152760-240152782 GAGTCTTAAGAAAGGGAACATGG - Intergenic
949025556 2:241765784-241765806 GAGTAGGAAGAGGGGGGAGAAGG + Intronic
949025753 2:241766334-241766356 GAGTAGGAAGAGGGGGGAGAAGG + Intronic
1169125427 20:3124229-3124251 GAGACCGAAGAAAGGGGAGAGGG - Intronic
1169176124 20:3516131-3516153 AAAATTGAAGAGAGGGAAGAAGG + Intronic
1169425494 20:5493723-5493745 GAGTTTGAAGTCAGGGTAGAAGG + Intergenic
1169882030 20:10357313-10357335 GTGGCAGGAGAGAGGGAAGAAGG + Intergenic
1170032688 20:11959300-11959322 GAGGGGGAAGAGAGAGAAGACGG + Intergenic
1170480431 20:16760103-16760125 GAGTTGGAAGAGATGGAAGGAGG - Intronic
1170828406 20:19817577-19817599 GACTCTAAGGAGAGGGAAGTGGG + Intergenic
1171801760 20:29627130-29627152 GTGGCAGAAGAGAGGGAAGTAGG + Intergenic
1171842213 20:30228341-30228363 GTGACAGAAGAGAGGGAAGTAGG - Intergenic
1171949726 20:31410359-31410381 GAGTCAGGAGAGAGGGAGGGAGG + Intronic
1172119226 20:32588026-32588048 GAGACTGAAGTGAGGGAGGAGGG + Intronic
1172573001 20:35984916-35984938 GAGTCTGCAGAGAGAGAAGGTGG - Intronic
1172674718 20:36660306-36660328 GGGTTGGAAGTGAGGGAAGAAGG + Intronic
1173241183 20:41298787-41298809 GAATCTGAAGAGAGGGACTTGGG + Intronic
1173297372 20:41771708-41771730 GAGGCTGAAGAAAGGGAAGCAGG + Intergenic
1173334921 20:42104724-42104746 AAGTCAGAAGAGAGGGAATGGGG + Intronic
1173418041 20:42876034-42876056 GAGGATGGAGAGAGGGAAGGAGG - Intronic
1173481197 20:43400886-43400908 GAGTCTGCAGTGAGCCAAGATGG - Intergenic
1173501769 20:43559081-43559103 GACCATGAAGAGAGAGAAGAGGG + Intronic
1173751801 20:45482274-45482296 GAGTATGGAGAGGGGGAGGATGG - Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174637957 20:52018045-52018067 GAGTCTGAAGAAATTGAGGAGGG + Intergenic
1174700020 20:52598508-52598530 GAGCGTGAAGAGTGGGAGGAGGG + Intergenic
1175410235 20:58762956-58762978 GAACCCGAAGAGAAGGAAGAGGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1176453969 21:6891806-6891828 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1176514716 21:7775352-7775374 GACACTGAAGGGAGAGAAGAAGG - Intergenic
1176832144 21:13756854-13756876 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177499073 21:21927474-21927496 AAGTCTGAAGTCAGGCAAGAAGG + Intergenic
1177548870 21:22595409-22595431 GAGTGAGAAAAGAGGGAATAAGG + Intergenic
1177557379 21:22709794-22709816 GAGAGTGAAGAGTGGGAGGAGGG + Intergenic
1178005479 21:28215236-28215258 GAGTAAGATGAGAGGGAAAAGGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178648829 21:34405876-34405898 GACACTGAAGGGAGAGAAGAAGG - Intronic
1178730818 21:35101044-35101066 GATACTGCAGAGAGGGAAGAGGG - Intronic
1179523495 21:41960486-41960508 GAGTCTGGAGAGAGGGTGCACGG + Intergenic
1180261127 21:46669612-46669634 GATTCTGAAGAAAGGGAAGAAGG - Intergenic
1180875450 22:19173060-19173082 GAATCTGGGGAGCGGGAAGATGG + Intergenic
1181286805 22:21758422-21758444 GAGCAAGGAGAGAGGGAAGAAGG - Exonic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1182209022 22:28658523-28658545 GAGGCTGGAGAGAGGGAATAGGG + Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182462462 22:30492194-30492216 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182467430 22:30525971-30525993 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182725828 22:32444595-32444617 GTGTCTGAAGAAGGGAAAGATGG - Intronic
1182988674 22:34745301-34745323 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183153237 22:36054037-36054059 GAGACTGAAAATAGGAAAGAAGG - Intergenic
1184064126 22:42106354-42106376 GAAGGAGAAGAGAGGGAAGAGGG + Intergenic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
949188105 3:1218212-1218234 GAGCCTGAGGAAGGGGAAGAGGG + Intronic
950024646 3:9811791-9811813 GAGGCTGGAGAGAGGTCAGAAGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950515473 3:13462122-13462144 TAGTCTGAATGGAGGGAACAAGG + Intergenic
950575945 3:13832126-13832148 GAGCCTGAGGAGGAGGAAGAGGG - Intronic
950586110 3:13893731-13893753 GAGACGTAAGAGAGGGAGGATGG - Intergenic
950881030 3:16322781-16322803 GAGTCCGGAGAGGGGGAAAAGGG + Intronic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951206838 3:19934332-19934354 GAGACAGAGGAGAGAGAAGAGGG - Intronic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952227331 3:31391866-31391888 GACACTGAAGAGTGGGAAGTTGG - Intergenic
952238104 3:31501177-31501199 GACTCTGCAGAGAGGGATTATGG + Intergenic
952307518 3:32159137-32159159 GAGTCTCAAGTGAGGAAGGAGGG - Intronic
952352497 3:32553630-32553652 GCTTCTGTAGAGAGGGAAGTGGG - Intronic
952430221 3:33216565-33216587 GAGCCTGGAGTGAGGGAAGCTGG - Intronic
952458409 3:33497590-33497612 GATCCTGATGAGAGAGAAGATGG - Exonic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
952713756 3:36457499-36457521 GAGTCTGGAAATAGGGAAAAGGG + Intronic
953584941 3:44191156-44191178 GGGTCTGAAGAGATTTAAGATGG + Intergenic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954163550 3:48738963-48738985 GAGTCTGATGAGGAGGTAGAGGG + Intronic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955252161 3:57294587-57294609 GAATGAGAAGGGAGGGAAGAAGG + Intronic
955783483 3:62510989-62511011 AGGACTGAAGAGAGGGAATAGGG - Intronic
955828828 3:62979942-62979964 GACCCTGAAAAGAGAGAAGAGGG - Intergenic
955858407 3:63299522-63299544 GATTCTCAAGAGAGAGAAAATGG + Intronic
955915504 3:63904093-63904115 GAGGCTGAAGGAAGAGAAGATGG - Intronic
956203920 3:66736664-66736686 GAGGCAGTAGGGAGGGAAGAGGG - Intergenic
956511875 3:70001744-70001766 GAGTCTAAAGAGAGATAAGCTGG - Intergenic
957062942 3:75496886-75496908 GAGTCTCCATAGAGGGGAGAGGG + Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
958959986 3:100500486-100500508 GAGTCCAGAGAGAGGGAACAGGG - Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
960369974 3:116823220-116823242 GAGAGTGAAGAGAGGGGAGGTGG + Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
961345320 3:126260216-126260238 GAAGATGTAGAGAGGGAAGAGGG - Intergenic
961345498 3:126260813-126260835 GAAGATGAAGAGAGGAAAGAAGG - Intergenic
961996106 3:131245089-131245111 GACTCAGAAGAGTGGGAAGTTGG - Intronic
962400847 3:135057526-135057548 GACTCTATAGAGAGGGAAGAAGG - Intronic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963781836 3:149494212-149494234 GAGTTTGAAGGGAGAGAAGAAGG + Intronic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964455393 3:156860065-156860087 GACTCTGAAAAGTGGAAAGAAGG - Intronic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965059227 3:163762199-163762221 GACTCAGAAGAGTGGGAGGATGG - Intergenic
965489320 3:169317531-169317553 TACTCTGGAGAGAGGAAAGAAGG - Intronic
965545638 3:169913529-169913551 GAGTCTGAAGACAGAGATTAAGG + Intronic
966117182 3:176479344-176479366 GATTTTGAACAGAGGGAAAAAGG + Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966878724 3:184337954-184337976 GAGGCTGGCGAGAGGAAAGAAGG + Intronic
967348822 3:188489355-188489377 GTGACTGGAGAGAGGCAAGAAGG + Intronic
967927980 3:194667394-194667416 GAGACAGTAGAGAGGGAAGTTGG - Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
969167195 4:5326500-5326522 GAACCTGCAGAGAGGGAAGCAGG - Intronic
970142708 4:12999567-12999589 GAAACTGAAGACAGGAAAGATGG + Intergenic
970242387 4:14022912-14022934 GACACTGAGGAGAGGGAACATGG + Intergenic
970705527 4:18797208-18797230 GAGTCTGGAGAGAGTTTAGAAGG - Intergenic
970870303 4:20809396-20809418 GAGTCTGAAGGGAATGAAGTAGG - Intronic
970942841 4:21655417-21655439 GAGTCTAAAGGGAGGGCAGGAGG + Intronic
971078092 4:23173767-23173789 GAGGCTGAAGACACAGAAGAGGG - Intergenic
971570942 4:28210001-28210023 GAGGAGGAAGAGGGGGAAGAGGG - Intergenic
971603432 4:28625503-28625525 GAGCCTGTAGACAGAGAAGAGGG + Intergenic
971890099 4:32508611-32508633 GAGTCTGAAGGGAGGGGGGATGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973885552 4:55317461-55317483 GAGAGTGAAGAGTGGGAGGAAGG - Intergenic
974081284 4:57215928-57215950 GTGACTGTAGAGATGGAAGAGGG - Intergenic
974107508 4:57486870-57486892 GAGGCTGCAGTGAGGCAAGATGG + Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
975097987 4:70479621-70479643 GAGATTGAATACAGGGAAGAGGG + Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975156911 4:71082372-71082394 GAGTAGGAAGACAAGGAAGATGG - Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975727847 4:77309302-77309324 GAATGTGGAGAGTGGGAAGAGGG - Intronic
975791286 4:77954570-77954592 GACTCAGAAGAGAGGGAGGGTGG + Intergenic
976642523 4:87353976-87353998 GAGTCTGAAGAGAGAAGAGAAGG - Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
976687450 4:87830578-87830600 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
976805157 4:89037809-89037831 GAGGAGGAAGAGAGGAAAGAGGG - Intronic
977323919 4:95550752-95550774 GAAGATGAAGAGAGTGAAGAAGG - Intergenic
977969656 4:103198551-103198573 GAGTCGGAGGAGAGGGCCGAAGG + Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978625797 4:110683961-110683983 GAGACAGAAGGGAAGGAAGAAGG + Intergenic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979702357 4:123684314-123684336 GAGACAGAAGAGAGGGGAGAGGG - Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
981713191 4:147728957-147728979 TGGGCTGAAGAGAGGGATGAGGG - Intergenic
981902652 4:149884909-149884931 GAGTCTGAAGGGAGGGAGGAGGG + Intergenic
982670502 4:158314345-158314367 GAGGCTGAAGAGGGAGAAGCTGG - Intergenic
983408839 4:167370298-167370320 GAGACTGAAAAGTAGGAAGAAGG + Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983692771 4:170492358-170492380 GAGTCTGAAGTCAGGGCAGAAGG - Intergenic
983907745 4:173202518-173202540 GAGACAGAAAAGAGTGAAGAGGG - Intronic
984674461 4:182531020-182531042 GAGTCTGGAGAGAGTGTAGATGG + Intronic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
986538120 5:8813976-8813998 GAGCGTGGAGAGAGGGAAGGTGG - Intergenic
987567092 5:19603343-19603365 GAGACTCAGGAGAGGGAAAATGG + Intronic
987979295 5:25060368-25060390 AACTCTGAAGAGATGGCAGAAGG - Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
989413966 5:41152143-41152165 TATTCTGAAGAAAGGGAACATGG + Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
990161469 5:52944400-52944422 GAGGCTGAAGAGGGAGAAGCTGG - Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
991987003 5:72299118-72299140 GAGGCAGGAGAGAGGGAAGGGGG + Intronic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992377122 5:76198959-76198981 GAGCCTGAAAAGAGGGCACAAGG + Intronic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994435186 5:99720594-99720616 GAGGCAGAAGAGTGGGAGGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995189983 5:109309871-109309893 GAGACTGGAGAGTGGGCAGAGGG - Intergenic
995191895 5:109326711-109326733 GAGACAGGAGAGAGGGAAGAAGG + Intergenic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
997017679 5:129955681-129955703 GAGAGTGAAGAGTGGGAGGAGGG - Intronic
997079442 5:130721507-130721529 GAAACTTCAGAGAGGGAAGAAGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
997438128 5:133889852-133889874 GACACTGAAGGGAGGGAAGGAGG - Intergenic
997585397 5:135040351-135040373 GCCCCTGAGGAGAGGGAAGAAGG - Intronic
998377110 5:141698482-141698504 AAGGCGGAAGAGAAGGAAGAGGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999889299 5:155959321-155959343 GAACCTGAAGAGAGGGATGAAGG - Intronic
1000303656 5:159976819-159976841 GTGTCAGAAGAGATGGAGGAGGG + Intergenic
1000362701 5:160462718-160462740 GAGTTTGTAGAGGGGGAAGCAGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000792178 5:165621572-165621594 CAGGCTGAAGAGAGGAAAAAAGG - Intergenic
1000850561 5:166334998-166335020 GAGTATGAAGAGAAGAAAGAAGG + Intergenic
1001451300 5:171826775-171826797 GAGTCTGCAGAAGGTGAAGATGG + Intergenic
1001471861 5:172019965-172019987 GAGGCTGAAGTGAGCCAAGATGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001923906 5:175622322-175622344 GAGTTTGAGGAGGGAGAAGAGGG - Intergenic
1002072719 5:176689873-176689895 GAGTCCTTAGAGATGGAAGAGGG - Intergenic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1002971465 6:2026247-2026269 GAGTTTGAAGTGAGAGAAGCTGG - Intronic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1004272008 6:14203994-14204016 GATTTGGAAGAGAGGAAAGAGGG - Intergenic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1004409721 6:15369736-15369758 GAGTCTGAACAGATGTAAGTGGG + Intronic
1004614789 6:17280465-17280487 GGGTCTGAAGAGTGAGAAGGAGG - Intergenic
1004659330 6:17696271-17696293 GAGTCTGACAAGAGGAAAAACGG + Intronic
1005511588 6:26516762-26516784 GTGTCTGAAGAGGAGGAATAAGG - Intergenic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1005913673 6:30332850-30332872 GAGTCTGATGAGGGAGAAGGAGG - Intronic
1006084800 6:31587969-31587991 GAGTCTGGGGACAGGGAAGGGGG + Intronic
1006109186 6:31734625-31734647 GAGTCTGAAGACAGGAGAGGTGG + Intronic
1006250787 6:32781915-32781937 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1006561537 6:34917177-34917199 GAGCCAGGAGAGAAGGAAGAAGG + Intronic
1006888279 6:37400475-37400497 AAGTCTGAAAATATGGAAGAGGG + Intergenic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007609673 6:43141479-43141501 GAGACTGAAGAATTGGAAGAGGG + Intronic
1007678916 6:43621088-43621110 GAGTCTGAAGAAATGGCACAGGG - Exonic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1007915129 6:45554317-45554339 GTGCCTGAAGGGAGGGAAGGAGG + Intronic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1009359066 6:62791921-62791943 GAGTCTGAAAAGAGAGCAAAGGG - Intergenic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1009643135 6:66362959-66362981 GAGACTGAAGGGGGGGATGAGGG - Intergenic
1010017354 6:71120975-71120997 GATCCTTAAGAGAGAGAAGAAGG - Intergenic
1010025752 6:71214359-71214381 TAGTCTGAAAAGATGAAAGAAGG + Intergenic
1010255644 6:73754275-73754297 GAGCCTGAAGAGTGGGAAGAGGG + Intronic
1010318834 6:74483202-74483224 GAATATGTAGAGAGGGAGGAAGG - Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010941306 6:81921097-81921119 AACTCTGAAGAGTGGAAAGAAGG + Intergenic
1011218648 6:85031850-85031872 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1011855718 6:91688384-91688406 AGGTATGAAGAGAGGGAAGGAGG - Intergenic
1013088593 6:106877644-106877666 GAGTTTGATGGAAGGGAAGAAGG - Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1014246590 6:119077114-119077136 GATTCGGAAGAGAGGAAAGGAGG - Intronic
1014458816 6:121669979-121670001 GTACCTGAAGAGAGGGATGATGG - Intergenic
1014960620 6:127679598-127679620 GAATGTGAAGGGAGGCAAGATGG - Intergenic
1015293864 6:131568575-131568597 GAGTCTAAAAATAGGGAAGAAGG - Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015640520 6:135326897-135326919 GAGTCAGAAGAGTGGAAGGAGGG - Intronic
1016660781 6:146577036-146577058 GAGACTGAAGAGAGGAGGGAGGG + Intergenic
1016737359 6:147493890-147493912 GACTCTGAGGAGCGGGAGGAGGG - Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016846695 6:148575047-148575069 GAGTCAGAAGGGAGGGAGCATGG - Intergenic
1016862496 6:148734858-148734880 GAGTCTGAAAACAAGGAAAAGGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017928130 6:158928120-158928142 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018136470 6:160782820-160782842 GAGCCGGGAGAGAGGGAGGAAGG - Intergenic
1018151429 6:160943671-160943693 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1018231907 6:161683165-161683187 GAGGCAGAAGGGAAGGAAGAAGG + Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018512242 6:164537576-164537598 GAGAGTGGAGAGTGGGAAGAGGG + Intergenic
1018946313 6:168348759-168348781 GGGTCTGGAGAGAGGGATGCAGG + Intergenic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019483577 7:1277285-1277307 GAGGGAGAAGAGAGGGAAGGAGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020351539 7:7224956-7224978 AAGACTGGAGGGAGGGAAGAGGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1022266949 7:28766262-28766284 CCTTCTGAAGAAAGGGAAGAAGG + Intronic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022850497 7:34256873-34256895 GAGTCAGAGAAGAGGGAACAAGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023447919 7:40251222-40251244 GGAAGTGAAGAGAGGGAAGATGG - Intronic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023765565 7:43507373-43507395 TGGTCTGAAGCGGGGGAAGAAGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023959241 7:44912966-44912988 GAGGCTGAAGGGAGGGCAGCAGG - Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024690458 7:51796058-51796080 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1025290665 7:57719053-57719075 GTGGCAGAAGAGAGGGAAGTAGG - Intergenic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027607170 7:80314827-80314849 GAGTCAAAAGAGATGAAAGAAGG - Intergenic
1028125213 7:87104942-87104964 GAAGCTGAAGAGAGGGGAGCAGG + Intergenic
1028538168 7:91912477-91912499 GAGTTTGATGAGAGAGGAGATGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028885355 7:95926821-95926843 GAGTCTCAGGAGAGGGCAGGTGG - Intronic
1028889310 7:95969252-95969274 AAGACTGAAGATAAGGAAGATGG + Intronic
1030162034 7:106518688-106518710 GAGTTTGGAGAGAGAAAAGAGGG - Intergenic
1030218305 7:107069612-107069634 GAGTCGGAGGAGTGGGCAGATGG + Intronic
1030367866 7:108666822-108666844 GAAGAAGAAGAGAGGGAAGAAGG - Intergenic
1030582953 7:111383157-111383179 GAGACTGAAGAGAATAAAGAGGG + Intronic
1030620549 7:111785625-111785647 GATTCCCAAGAGAGGGAACAAGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1030967867 7:116016345-116016367 GAATGTGGAGAGAGAGAAGAAGG - Intronic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1031489866 7:122373322-122373344 GAGTCTTAAGTTTGGGAAGAGGG - Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031714764 7:125095229-125095251 GAGTCTGGATATAGGGAAAATGG + Intergenic
1033040447 7:137912921-137912943 GGGTCTACAGAGAGGGAATATGG - Intronic
1033063037 7:138126194-138126216 GAATCTGAAGTGAGGGAAGCAGG - Intergenic
1033537890 7:142328839-142328861 GAGTCTGGGGTGAGGGAGGAGGG - Intergenic
1033735916 7:144221657-144221679 GAGGTTGAAAACAGGGAAGACGG - Intergenic
1033747135 7:144329295-144329317 GAGGTTGAAAACAGGGAAGACGG + Intergenic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034662657 7:152785521-152785543 GAGAGAGAAGAGAGGCAAGAGGG + Intronic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1035687987 8:1539660-1539682 GAGTCTGGAGAGGGAGAAGGTGG - Intronic
1036059198 8:5295970-5295992 GCCTCTGAAGAGAGAGAAGGAGG + Intergenic
1036402859 8:8425901-8425923 GAGTCTGCAGAGATAGAAAAAGG + Intergenic
1036497981 8:9287016-9287038 GACTCCAAGGAGAGGGAAGATGG - Intergenic
1036506060 8:9357390-9357412 GAGTGTGGAGAGTGGGAGGAGGG + Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037085777 8:14847732-14847754 GAGGCGGGAGAGAGGGAAGGAGG + Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037234109 8:16696228-16696250 GAAAGAGAAGAGAGGGAAGAAGG - Intergenic
1037607371 8:20449078-20449100 GCTTTTGAAGGGAGGGAAGAAGG - Intergenic
1037759465 8:21732443-21732465 GAGTCTGCGGAGAGGGGAGGGGG + Intronic
1037782759 8:21881974-21881996 AAGTTTGAAGAGAGAAAAGAAGG - Intergenic
1038110242 8:24488625-24488647 AAGTCAGAAGAAAAGGAAGATGG + Intronic
1038258217 8:25970517-25970539 GAGCCTGAAGAGTGGGGAGGGGG - Intronic
1038387417 8:27161995-27162017 AGGGCTGAAGAGAGGAAAGATGG + Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038884882 8:31652264-31652286 GAAGTTGAAGTGAGGGAAGACGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039426925 8:37493737-37493759 AAGGCTGGAGAGAGGGAACATGG - Intergenic
1039578914 8:38648038-38648060 GAGTTTGAAGAGAGAAAACAAGG + Intergenic
1039727380 8:40233318-40233340 GAGGCTGTTGAGTGGGAAGACGG - Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1041095252 8:54343164-54343186 GAAGGAGAAGAGAGGGAAGAAGG - Intergenic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1041577839 8:59420398-59420420 GAGGGTGAAGGGTGGGAAGAAGG + Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1042667587 8:71223236-71223258 GAAGCTGAAAAGAGGGCAGATGG + Intronic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1043270569 8:78328743-78328765 GAGAGTTAAGAGAGGGAACATGG - Intergenic
1043991548 8:86761998-86762020 AAATCTGAAGAAAGGGAAAAAGG - Intergenic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1044760257 8:95510305-95510327 GAGGCTGCAGGCAGGGAAGAGGG - Intergenic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045829958 8:106446859-106446881 GAGTCTGCAGTGAGCCAAGATGG + Intronic
1046287720 8:112116507-112116529 GACTCTGAAAAGAGGGAAGCAGG + Intergenic
1046453261 8:114421768-114421790 GAGAGTGAAGAGTGGGAGGAGGG + Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047737554 8:127779869-127779891 GGGACTGAGGAGAGGGAAAATGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1048102422 8:131368224-131368246 GAGTATGAGGAAGGGGAAGATGG + Intergenic
1048540897 8:135341644-135341666 GAAACTGATGAGGGGGAAGAAGG - Intergenic
1048771530 8:137900741-137900763 TCCTCTGAAGAGCGGGAAGAGGG + Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049974110 9:845639-845661 GAGGCTGAAGGCAGGGAGGAAGG - Intronic
1050013157 9:1205955-1205977 GAGGCAGTAGAGAGGGAGGAGGG + Intergenic
1050039679 9:1476088-1476110 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1051599474 9:18858376-18858398 GAGGCTGAACAGAGTGAAAAGGG - Intronic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1051625427 9:19094724-19094746 GAGTCTGCAGTGAGCCAAGATGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052119775 9:24698289-24698311 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
1052260275 9:26507249-26507271 GAGGCTGAAGAGATGGGAGTGGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054076631 9:60544289-60544311 GAGTCTGAAAAGAGAGCAAAGGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054165777 9:61726321-61726343 GTGGCAGAAGAGAGGGAAGTAGG + Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1055619065 9:78104829-78104851 GAAGATGAAGGGAGGGAAGAAGG - Intergenic
1055833632 9:80413311-80413333 GAGTGTGAAGAGTGGAAGGAGGG - Intergenic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058896251 9:109403011-109403033 GAGGCTGAAGTGAGCCAAGATGG + Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059131841 9:111760136-111760158 GAGGCTGTAGATAGGGAAGATGG - Intronic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059532319 9:115046852-115046874 GAGTCAGGAGAGGGGAAAGATGG + Intronic
1059569245 9:115416420-115416442 GAATCAGAAGAGAGGCAAGAAGG - Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1061027902 9:128062479-128062501 GAGTCAGCAGAGAGGAAAGGAGG + Exonic
1061281931 9:129602542-129602564 GAGTCAGAAGAGAAGAAAGCGGG + Intergenic
1061427337 9:130507558-130507580 GAGGCTGCAGTGAGGCAAGACGG - Intergenic
1061451713 9:130670490-130670512 GGGTTTGAAGTGAGGTAAGACGG + Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1061764781 9:132874941-132874963 GTGTCTGAAGGGAGGTCAGAAGG - Intronic
1061929530 9:133825257-133825279 GAGACTGGAGAGACGGAAGACGG - Intronic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185545834 X:943551-943573 TAGACAGAAGAGAGGGTAGAAGG + Intergenic
1185586315 X:1244376-1244398 GAATGTGAAGGGAAGGAAGAAGG + Intergenic
1185592511 X:1286923-1286945 GAGACAGAAGAGCGGGGAGAGGG + Intronic
1186400672 X:9256425-9256447 GAGGCTCGAGAGAGGGAAGGAGG + Intergenic
1186504373 X:10079055-10079077 GGGTCTGAAGAGACGAAACATGG - Intronic
1186567203 X:10676398-10676420 GGGTCAGAAGGGAGGGAAGTTGG - Intronic
1186570592 X:10711133-10711155 GAGTCTGAAGTAAGGGAGGAAGG - Intronic
1186760606 X:12718199-12718221 GAGGCCGAAGGGAAGGAAGAAGG + Exonic
1186878588 X:13841606-13841628 GAGGCTGAAGAAAGGGGTGAGGG - Intronic
1188072086 X:25729483-25729505 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
1188335446 X:28926746-28926768 AGGTTTGAAGAGAGAGAAGAAGG - Intronic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188994987 X:36873082-36873104 GAGTGTGAAGGGTGGGAGGACGG + Intergenic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189372598 X:40440923-40440945 GAGTCAGAAAACAAGGAAGAAGG - Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1189522342 X:41783077-41783099 GAGGCTGAAGTGAGCCAAGATGG + Intronic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1189938872 X:46099801-46099823 GGGTCTGATTAGAGGGTAGAGGG - Intergenic
1190136965 X:47806641-47806663 TGATCTGGAGAGAGGGAAGAGGG - Intergenic
1190404597 X:50074036-50074058 GAGGCTGAGGACAAGGAAGATGG + Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191853176 X:65601402-65601424 GAGTCAGGGGAGAGGGAGGAAGG - Intronic
1192103346 X:68289051-68289073 GTATCTGAAGAGAGGGCAAAAGG - Intronic
1192399136 X:70816822-70816844 GAGTCAGAGTAGAAGGAAGAGGG + Intronic
1192468271 X:71373747-71373769 GATTCTTGAGAGAGGGAATAGGG + Intronic
1193189843 X:78557604-78557626 GAGTATGATGAGAGAGATGAAGG - Intergenic
1193499926 X:82262936-82262958 GGGTCTCAAGAAAGGGAAAATGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1194851059 X:98869824-98869846 GAGTGTGGAGAGCGGGAGGAGGG - Intergenic
1196468686 X:115999633-115999655 GAGTCTGGAGAGAGACCAGAGGG - Intergenic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1199407546 X:147480166-147480188 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200010763 X:153119135-153119157 GAGGCTGCAGAGAGGTATGATGG - Intergenic
1200023057 X:153227835-153227857 GAATATGAAGTGATGGAAGATGG - Intergenic
1200028837 X:153280787-153280809 GAGGCTGCAGAGAGGTATGATGG + Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic