ID: 1174444361

View in Genome Browser
Species Human (GRCh38)
Location 20:50580476-50580498
Sequence GCCCCCACCAAAATATGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174444361_1174444366 13 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444366 20:50580512-50580534 TGTGATAGAGGTGTCCGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1174444361_1174444367 16 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444367 20:50580515-50580537 GATAGAGGTGTCCGCTGAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 83
1174444361_1174444370 26 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444370 20:50580525-50580547 TCCGCTGAGGTGGTCAGGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 291
1174444361_1174444369 22 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444369 20:50580521-50580543 GGTGTCCGCTGAGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 166
1174444361_1174444365 1 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444365 20:50580500-50580522 CATGGACAGTGATGTGATAGAGG 0: 1
1: 0
2: 1
3: 9
4: 133
1174444361_1174444368 21 Left 1174444361 20:50580476-50580498 CCAAAGCATATTTTGGTGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1174444368 20:50580520-50580542 AGGTGTCCGCTGAGGTGGTCAGG 0: 1
1: 0
2: 3
3: 5
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174444361 Original CRISPR GCCCCCACCAAAATATGCTT TGG (reversed) Intronic
900432942 1:2611523-2611545 ACCCCCACCAGACTATGCTTTGG - Intronic
901469825 1:9448569-9448591 GCCCCCACCATCATTTCCTTTGG - Intergenic
902682214 1:18051353-18051375 ACCCCCACCAAAATGTGCCCAGG - Intergenic
905569393 1:38991638-38991660 ACCCCCCCCAAAAAATGCCTGGG - Intronic
909126866 1:71683750-71683772 ACCCCCACCAAAAGTTACTTAGG + Intronic
920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG + Intronic
921106772 1:211988722-211988744 ACCCCCACCATATTTTGCTTAGG + Intronic
921407720 1:214799351-214799373 GCTGCCACCAAAATGGGCTTGGG + Intergenic
1063895199 10:10673027-10673049 GCCCTCAAAAAAAAATGCTTAGG - Intergenic
1066209891 10:33226342-33226364 GCCCACAGGAAAAGATGCTTTGG - Intronic
1071155959 10:82689639-82689661 TCCCCCTCCAAAATCTGCTCTGG - Intronic
1075785476 10:125046611-125046633 ACTCCCACCAAAACATTCTTAGG + Intronic
1077167292 11:1149443-1149465 GACCCCATCAAAATATTCGTGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1084798306 11:71524153-71524175 GGCCCCACCAACATAAGATTTGG - Intergenic
1086740647 11:90363934-90363956 GCCTCCACCAATATTTACTTTGG - Intergenic
1088396471 11:109375408-109375430 GTCCCCATGAAAATAGGCTTTGG - Intergenic
1095366303 12:41410602-41410624 GTACCCAACAAAATATACTTTGG - Intronic
1099587667 12:84541586-84541608 GCCTCCACCAAAAAATGCTTAGG - Intergenic
1104937760 12:132375546-132375568 GCCTCCAGGAAAACATGCTTGGG + Intergenic
1106310262 13:28548050-28548072 GCAGCCACCAAAATATAGTTAGG + Intergenic
1108892788 13:55281782-55281804 GCCCCCAGAAAAAAATGTTTGGG + Intergenic
1109995787 13:70124177-70124199 CCGCCCACCAATATTTGCTTGGG - Intergenic
1113159386 13:107362669-107362691 CCCCCCAGCAAAATATGTTGAGG - Intronic
1119657279 14:76426098-76426120 GCCCTCACCAAAATGTCCTCTGG - Intronic
1125331918 15:38590840-38590862 GCTCCCACAATCATATGCTTAGG - Intergenic
1126383848 15:48074250-48074272 GCCCCCACCTAACTATGCCAGGG + Intergenic
1127077517 15:55342165-55342187 ACCACCACCAAAAACTGCTTTGG - Intronic
1130563135 15:84974324-84974346 GCTCCCATGAAAATAAGCTTTGG - Intergenic
1131548419 15:93335005-93335027 TCCCAAACCAAAATATTCTTGGG - Intergenic
1134048147 16:11116601-11116623 ACCCCCAGCAACATATGCCTCGG - Intronic
1140016221 16:71188394-71188416 TCCCCAACCAAAATTTGGTTTGG - Intronic
1145831649 17:27921191-27921213 GCCCCGACGAACACATGCTTCGG + Intergenic
1153108814 18:1559976-1559998 GCCACCACCAAAATGGGCTCAGG + Intergenic
1153880794 18:9420216-9420238 GCCACCACTGAAACATGCTTTGG - Intergenic
1157194862 18:45612707-45612729 GTCCCCACCCAAATATCGTTTGG + Intronic
1159500549 18:69263791-69263813 CCCCCCACCTATATATGCTCTGG + Intergenic
1165185152 19:34013363-34013385 GACTCCACCAAAACATGTTTAGG + Intergenic
1165850546 19:38848025-38848047 CCTCCCACCAAAATCTGCTTTGG + Intronic
1167986675 19:53324324-53324346 TTCCCCTCCAAAATCTGCTTGGG + Intergenic
931459675 2:62439775-62439797 TGCCACCCCAAAATATGCTTTGG + Intergenic
931877993 2:66534848-66534870 GCCCCTTCTAAAACATGCTTTGG - Intronic
933008408 2:77024216-77024238 GCCCCCACCCAAATCTCATTTGG - Intronic
934314180 2:91901249-91901271 GCACTCACAAAAATATGGTTTGG - Intergenic
942609520 2:177728348-177728370 GCCCCCACCTTCATTTGCTTGGG - Intronic
943675175 2:190709985-190710007 GTTCCCACCAACATATGTTTAGG + Intergenic
944120730 2:196237856-196237878 GCAGACACCAAAAGATGCTTCGG + Intronic
1169596077 20:7200571-7200593 ACCCCCACCAAAAAAAGCCTAGG - Intergenic
1169761753 20:9102728-9102750 GCCCCCCCCCAAATATGCTCTGG - Intronic
1170994951 20:21345311-21345333 GCCTCTACCAAGAAATGCTTGGG + Intronic
1172746076 20:37210172-37210194 CGCCCCACCAAAATATGATCAGG - Intronic
1174444361 20:50580476-50580498 GCCCCCACCAAAATATGCTTTGG - Intronic
1175503354 20:59465639-59465661 GCCCCCACCCACCTGTGCTTTGG + Intergenic
1178594576 21:33941426-33941448 GCCTCCTCCAAGATATTCTTAGG - Intergenic
1181428397 22:22858894-22858916 GCCCCCTCCATAATGTGGTTTGG + Intronic
1184669371 22:46004736-46004758 GGCCCCCACAAAACATGCTTGGG - Intergenic
951618902 3:24579365-24579387 TCCCCCACCAAAAGATACTGAGG - Intergenic
961751536 3:129098258-129098280 GCCCTCACCAACATAAGCCTTGG + Intronic
967113601 3:186317518-186317540 GCCACCACCAACACATGCTCTGG + Intronic
972090797 4:35280271-35280293 TCTCCCACTAAAATGTGCTTAGG + Intergenic
974387225 4:61217414-61217436 TCCTCCACCAGAACATGCTTGGG - Intronic
975442388 4:74426536-74426558 GCCCCCAATTAAATATGCATAGG + Intergenic
975558185 4:75684719-75684741 CACCCTTCCAAAATATGCTTAGG - Intronic
977067587 4:92337755-92337777 GTCCCCACCCAAATCTCCTTGGG - Intronic
981077661 4:140607262-140607284 TCCCCGACCCAAACATGCTTTGG - Intergenic
981878757 4:149581733-149581755 GTCCCCATTAAAATATGCTCAGG - Intergenic
987714913 5:21555695-21555717 GCTCCCACCAAAAGAAGCTAGGG - Intergenic
989135937 5:38154760-38154782 GCCCCCACCAGAAACTTCTTGGG - Intergenic
991447105 5:66711838-66711860 CCCCCCAAAAAAAGATGCTTTGG + Intronic
991729280 5:69568349-69568371 TCCCCCACCATTATATTCTTAGG + Intronic
991805713 5:70423495-70423517 TCCCCCACCATTATATTCTTAGG + Intergenic
991865673 5:71059526-71059548 TCCCCCACCATTATATTCTTAGG - Intronic
995786499 5:115835847-115835869 GTCCCCACCAACATGTGTTTTGG + Intronic
1002357998 5:178646472-178646494 ACCTCAACCAAAATATGCCTTGG + Intergenic
1004793374 6:19053351-19053373 GCCACCACAAAAACATACTTAGG + Intergenic
1008958828 6:57245115-57245137 GCCCCCACCAGTCTAGGCTTAGG + Intergenic
1009001810 6:57726334-57726356 GCTCCCACCAAAAGAAGCTAGGG + Intergenic
1011873523 6:91926962-91926984 GCCCCAGCCAAAATCTGCTTCGG + Intergenic
1016396531 6:143629219-143629241 TCCCCCTCCAGAAGATGCTTAGG - Intronic
1021509359 7:21418544-21418566 GGCCCCACAAAAATATGAGTGGG + Intergenic
1021544200 7:21794917-21794939 GCCCCTACCAAAATCTACTCAGG - Intronic
1024905216 7:54371542-54371564 GCCCATACCAAAATAAGCTGTGG - Intergenic
1031703656 7:124957101-124957123 GTCCCCACCCAAATATGATATGG + Intergenic
1032936299 7:136736130-136736152 GCCAACAACAAAAAATGCTTGGG + Intergenic
1033407459 7:141084141-141084163 GGCACAACCAAAGTATGCTTGGG + Intronic
1033777362 7:144627485-144627507 GTCCCCACCAAAATCTCATTTGG - Intronic
1035885244 8:3284442-3284464 ACCCCCACCAACATGTGCCTCGG + Intronic
1037324390 8:17673952-17673974 GTCTCCACCAAAATATGCCCAGG - Intronic
1038246268 8:25859290-25859312 GGCCCCGCCAAAAGATGCTATGG - Intronic
1044635026 8:94314594-94314616 GCCTCCTCCAAAAAATGATTAGG - Intergenic
1045894779 8:107202130-107202152 GTCCCCACCCAAATATTATTTGG - Intergenic
1056735287 9:89204541-89204563 TCCCCCACCAAAATTTGCCATGG + Intergenic
1057216334 9:93230805-93230827 GCCCCCACCTAACACTGCTTAGG - Intronic
1057715341 9:97490533-97490555 CCCCCCACCAAAATATATCTAGG - Intronic
1058588476 9:106535356-106535378 ACCCCCACCAAAATAAGCAAAGG + Intergenic
1060362698 9:122975214-122975236 GCCCTCAAGAAAACATGCTTAGG - Intronic
1060411461 9:123403136-123403158 GAACCCAGCAAAGTATGCTTTGG + Intronic
1061247295 9:129407143-129407165 TCCCCCACCAAAACATCCTGTGG - Intergenic
1186573109 X:10737184-10737206 ACCCCTTCAAAAATATGCTTAGG + Intronic
1192808263 X:74528696-74528718 GCCCCCACAAAAATGGGCTCTGG + Intronic
1199944038 X:152651440-152651462 GCCCCCACCCAAACATATTTGGG - Intronic