ID: 1174444437

View in Genome Browser
Species Human (GRCh38)
Location 20:50581058-50581080
Sequence GGGGGTGACAAGTGGACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174444424_1174444437 17 Left 1174444424 20:50581018-50581040 CCTACCCTGGGTGTGGGTGCTAT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1174444420_1174444437 27 Left 1174444420 20:50581008-50581030 CCTTGTGAACCCTACCCTGGGTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1174444425_1174444437 13 Left 1174444425 20:50581022-50581044 CCCTGGGTGTGGGTGCTATCTGA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1174444426_1174444437 12 Left 1174444426 20:50581023-50581045 CCTGGGTGTGGGTGCTATCTGAA 0: 1
1: 0
2: 0
3: 15
4: 98
Right 1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1174444423_1174444437 18 Left 1174444423 20:50581017-50581039 CCCTACCCTGGGTGTGGGTGCTA 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174444437 Original CRISPR GGGGGTGACAAGTGGACTTC AGG Intronic
902165515 1:14568242-14568264 GGGAGTGACAAGTGACCTTTAGG + Intergenic
902207257 1:14878199-14878221 TGGGGTGATAAGTGGCCTTCAGG - Intronic
904289319 1:29473924-29473946 GGTGGTGAAAAGGGGACATCGGG + Intergenic
906513078 1:46422690-46422712 GCGGGTGACAAGTGGCCTGGGGG + Intergenic
909242901 1:73237823-73237845 GGGTGAGACATGTGGGCTTCTGG + Intergenic
911488144 1:98527966-98527988 TGAGGTGAGAAGTGGACTGCAGG + Intergenic
913364597 1:118022810-118022832 TGGGGTGACAGGTGGAGTTCTGG + Intronic
922887089 1:229028432-229028454 GGGGGTGACCAGTGCAGTGCTGG - Intergenic
1071305239 10:84293767-84293789 GGGTGTGACAAGTGCTCATCCGG - Intergenic
1074492191 10:113947943-113947965 GGGGGTGCTGAGTGGCCTTCAGG + Intergenic
1075671146 10:124264914-124264936 GGTGGTGCCAAGTGGGCTGCAGG + Intergenic
1076126998 10:127982978-127983000 GTGAGTGGCACGTGGACTTCTGG + Intronic
1077456685 11:2685669-2685691 AGGGGTCCCATGTGGACTTCAGG + Intronic
1078826144 11:14932100-14932122 GGGGGTGACAAGTGAACATTGGG - Intronic
1081796925 11:45826862-45826884 GGGGGAGCCAAGTGGGCTCCTGG + Intergenic
1083172902 11:60933597-60933619 GGGGGGTGCGAGTGGACTTCTGG + Exonic
1084762239 11:71281297-71281319 GGGGGTGTCTTGTGGACTGCAGG - Intergenic
1085837532 11:79972727-79972749 GGGGGTGACAGGTGGAACACAGG + Intergenic
1088900206 11:114109950-114109972 GGGGGCCACAGGAGGACTTCTGG + Intronic
1092570438 12:9715704-9715726 GGGGATGGCAACTGGACCTCTGG - Intergenic
1098310183 12:69140689-69140711 GTGGGTGACCAGTGGCCTTGTGG + Intergenic
1103749365 12:123149186-123149208 AGGGGAGAGAAGTGGACTGCGGG - Intronic
1105260427 13:18775227-18775249 GGGGGTGGCAGATGGAGTTCTGG - Intergenic
1113052889 13:106234218-106234240 GGAGGGGACAAATGGGCTTCAGG + Intergenic
1114632395 14:24167540-24167562 GTAGGTGACAAGTGGCCTTGTGG - Intergenic
1115121789 14:29945748-29945770 AGGGGAGACAAGGGGACTTAAGG + Intronic
1115713350 14:36074643-36074665 GGGGGTGCAGAGTGGAATTCAGG - Intergenic
1120547033 14:85824852-85824874 GGTGGTGGCAAATTGACTTCTGG - Intergenic
1120617046 14:86719920-86719942 GTGGGTGAGAAATGGACTACCGG - Intergenic
1121919829 14:97870279-97870301 AGGGGTGACCAGTGGACTGCTGG + Intergenic
1122030697 14:98909346-98909368 GGGGTGGACAATGGGACTTCAGG + Intergenic
1123509556 15:20983039-20983061 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1123566778 15:21556778-21556800 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1123603039 15:21994071-21994093 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1123964306 15:25439340-25439362 GGGGGTGCCCAGAGGGCTTCCGG - Intergenic
1125056124 15:35360377-35360399 GTGGGTCACAAGAGGACTTCTGG + Intronic
1125508084 15:40278630-40278652 GGGGCTGACAAAGGGAGTTCAGG + Intronic
1125579569 15:40775805-40775827 AGTGCTGACAAGTGGCCTTCAGG - Intronic
1126359273 15:47829016-47829038 GGAGGGGAGAAATGGACTTCTGG + Intergenic
1127391419 15:58507899-58507921 GGGGGAGACGAGTGGACTTGGGG + Intronic
1129235960 15:74223917-74223939 GGGGGTGGGAAGGGGACTGCAGG + Intergenic
1131059734 15:89397387-89397409 AGGGGTGGCAAGTGCACTCCTGG - Intergenic
1131544549 15:93305223-93305245 GGGGTTGAAAATTGAACTTCTGG + Intergenic
1131592317 15:93762821-93762843 TGGGTAGACAAGTGCACTTCTGG - Intergenic
1131771574 15:95743547-95743569 AGGGGTCACAAGTGGATTTTTGG - Intergenic
1202975139 15_KI270727v1_random:283873-283895 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1132794348 16:1711980-1712002 TGGGGTGACAAGGGGAGCTCGGG - Intronic
1135615211 16:23905400-23905422 GGGGGTGAGGAGTGAAGTTCTGG - Intronic
1139516299 16:67454292-67454314 GTGAGTGACAAGTGGCCTGCAGG + Intronic
1141413086 16:83849592-83849614 GGAGGTGGCACGTGGCCTTCTGG - Intergenic
1143335617 17:6169588-6169610 GGGGGTGAATAGTGGCCTCCTGG - Intergenic
1147327470 17:39676372-39676394 GGAGGTGAGAAGAGGACTGCAGG + Intronic
1149010102 17:51847386-51847408 GGGGGTGGTGAATGGACTTCTGG + Intronic
1150522836 17:65887788-65887810 AGGGGTGGCAAGAGGACTGCAGG - Intronic
1150778872 17:68102531-68102553 AGGGGAGACAGGTTGACTTCCGG + Intergenic
1151211896 17:72550595-72550617 CAGGGTGACACATGGACTTCTGG - Intergenic
1153980285 18:10302892-10302914 TGGGGTGACAGGTGGACTGGAGG - Intergenic
1155497731 18:26459162-26459184 GGAGGTGGTAAGTGGATTTCTGG - Intronic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1158935041 18:62356721-62356743 CGAGGTGACAAGTGGACATTGGG - Intronic
1160989315 19:1854102-1854124 GGGGGGGTGGAGTGGACTTCTGG - Exonic
1162619021 19:11825748-11825770 GTGGCTCACAAGTGGAATTCAGG - Intronic
1164115576 19:22215782-22215804 GGGGGGGACAGGTCGGCTTCCGG - Intergenic
1164529666 19:29038789-29038811 GTGGGTCACAAGTGGACCTGAGG + Intergenic
1166887904 19:45973018-45973040 GGGGGTGATAAGTGTCCTTGGGG - Intronic
925918871 2:8625830-8625852 GTGGGTCACACGTGGACATCTGG - Intergenic
927477381 2:23423989-23424011 GGGTGTGACAGGTGGACAGCTGG - Intronic
927910307 2:26893107-26893129 GGGAGTGACAACTGTACTCCAGG - Intronic
928040405 2:27870220-27870242 GGGGGTGACAAGTGAACATGGGG - Intronic
931693441 2:64854634-64854656 GGGGGTGGGAAGTGGAGTTTTGG - Intergenic
931799163 2:65741728-65741750 GGATGTGACAAGTGGATTTATGG + Intergenic
937254608 2:120546347-120546369 GGGATTGACAAGTGGATTCCAGG - Intergenic
937900025 2:127012639-127012661 TGGGGAGACAGGTGGACCTCCGG - Intergenic
937980867 2:127614597-127614619 GGAGGTGGCAAATGGGCTTCTGG + Intronic
945921462 2:215759395-215759417 GTCGCTGACAAGTGGACTTATGG + Intergenic
948164612 2:235851396-235851418 GGGGGTGACATGCGGACACCTGG - Intronic
948272245 2:236683555-236683577 GGGGCTCAAAAGTGGAGTTCTGG - Intergenic
1171141565 20:22748126-22748148 GGAGGAGACAAGTGGAGTTGAGG - Intergenic
1171398728 20:24857879-24857901 GAGGGTGAGATGTGGAGTTCAGG - Intergenic
1172776632 20:37411258-37411280 GAGGGTGACAAGTGCACAGCCGG + Intergenic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG + Intronic
1178067252 21:28918360-28918382 AGGCATGACCAGTGGACTTCAGG + Intergenic
1178275976 21:31237244-31237266 GGAGGTGTCAAGTGGACTTGTGG - Intronic
1182073937 22:27482064-27482086 GGGAGTGACAAGCAGGCTTCAGG - Intergenic
1184630499 22:45774506-45774528 GGAGGTGTCAGGTGGACATCTGG - Intronic
1184937462 22:47735586-47735608 GGGGATGAAAAGGGGTCTTCTGG + Intergenic
1185295220 22:50049772-50049794 GGGCCTGAGGAGTGGACTTCAGG + Intronic
951619520 3:24585876-24585898 GTGGGTGATATGTGGACTTGAGG + Intergenic
952961780 3:38596664-38596686 GGGGGTGGTAGGGGGACTTCTGG - Intronic
956516338 3:70052586-70052608 GGTGGTGGTAAGTGGAATTCTGG + Intergenic
956650718 3:71502059-71502081 TAGGGTGCCAAGTGGGCTTCTGG - Intronic
959213512 3:103419455-103419477 GCTGGTGGCTAGTGGACTTCAGG + Intergenic
967193600 3:187006719-187006741 GGTGGTTAAAAGTGGACTTTGGG - Intronic
968481242 4:833967-833989 CTGGGTGACAAGTGGAGTTGTGG + Intergenic
969751158 4:9112219-9112241 GAGAGTGACAATTGGGCTTCTGG + Intergenic
973829907 4:54748153-54748175 TGGGCAGGCAAGTGGACTTCAGG - Intergenic
975789376 4:77932217-77932239 GGGGGTGACTAGTGAACATTGGG + Intronic
982767951 4:159369302-159369324 GGGGGTGCCCACTGGACTCCTGG - Intergenic
990015744 5:51060063-51060085 GAGGGTGAGAAGGGAACTTCAGG + Intergenic
993605408 5:89984815-89984837 GGAGATGACAAATGGATTTCAGG + Intergenic
1002431972 5:179208980-179209002 GGGGGTGAAAAGTGTTGTTCTGG - Intronic
1002873369 6:1188041-1188063 GGTGGTGACAACTGAACTCCAGG - Intergenic
1003645334 6:7909988-7910010 CGGGGTGACATTTGGACTCCCGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1014620522 6:123661273-123661295 GGTGGTGAGAAGTAGAATTCTGG - Intergenic
1022340145 7:29460133-29460155 TGGGGTACCAAGTAGACTTCTGG + Intronic
1024458501 7:49635676-49635698 GGTGGTGCCAAGTGGAGTTGAGG - Intergenic
1025610489 7:63072424-63072446 GGGGGTGTCTAGTGGCCTTGGGG - Intergenic
1027144949 7:75688046-75688068 GGGGATGGTAAGTGGCCTTCAGG - Intronic
1038838719 8:31158866-31158888 GGGAGTGGCCAGGGGACTTCAGG + Intronic
1039272577 8:35899122-35899144 GGGGGTGGCAAATGGACCCCTGG + Intergenic
1040284237 8:46091875-46091897 GGGGGTGCCTTGTGGGCTTCTGG - Intergenic
1043231196 8:77803498-77803520 GGGGGTGACAAGTGAACACTGGG - Intergenic
1045813067 8:106246607-106246629 GGGGGTGACAAGTCAACATCGGG + Intergenic
1046804878 8:118469113-118469135 AGAGATGACAAGGGGACTTCTGG - Intronic
1048646093 8:136421450-136421472 GGAGGGGACAGGTGGAATTCAGG + Intergenic
1049365468 8:142234843-142234865 TGGGGGGACGAGGGGACTTCAGG - Intronic
1049365483 8:142234891-142234913 GCGGGGGACAAGGGGACTTTAGG - Intronic
1054765817 9:69041651-69041673 GGGGGTGACAAGGGGACACCTGG + Intronic
1060206817 9:121687058-121687080 GAGGGTAGCAAGTGGACTTCTGG + Intronic
1061159006 9:128882536-128882558 GGGGATGACAAGGGGACATGGGG - Exonic
1061188793 9:129070159-129070181 GTGGTGGACAAGGGGACTTCAGG + Intronic
1062108023 9:134766269-134766291 GGGGCTGATCAGTGGACCTCTGG + Intronic
1186292751 X:8118470-8118492 GTGGGTGACAAGAGGATTCCTGG + Intergenic
1187537240 X:20153460-20153482 AGGAATGACAAGTGGATTTCAGG + Exonic
1198937269 X:141911488-141911510 GGAGGTGACAAGGGTACTTTGGG + Intergenic
1198961784 X:142191377-142191399 GGAGGTGACAAGGGTACTTTGGG - Intergenic
1199962687 X:152789891-152789913 AGGTTTGACAAGTCGACTTCTGG - Intergenic