ID: 1174449132

View in Genome Browser
Species Human (GRCh38)
Location 20:50609097-50609119
Sequence GAAAATGGACAGAGGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174449132 Original CRISPR GAAAATGGACAGAGGGTGCT GGG Intronic
900378958 1:2374183-2374205 GAAATTGGACAGAGGCCACTTGG + Intronic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
900986239 1:6074232-6074254 GGAAATGGACAGTGGATGTTGGG - Intronic
901714961 1:11145900-11145922 TCATAAGGACAGAGGGTGCTTGG - Intronic
903813692 1:26049220-26049242 GAAAATGGGCAGAGGTTGTGAGG + Intergenic
903976696 1:27154807-27154829 GGAAAAGGAGAGAGGGGGCTGGG + Exonic
904016482 1:27425381-27425403 TAAAATGGAAAAAGGGGGCTTGG - Intronic
904659605 1:32074604-32074626 GAAATTGGAGAGAGAGTGATGGG + Intronic
906097766 1:43235849-43235871 GACAGGGCACAGAGGGTGCTAGG - Intronic
906127393 1:43435572-43435594 GAAAAGTGAAAGAGGGTGATAGG + Intronic
906246176 1:44275848-44275870 CAAAATGGACTGAGGGAGGTGGG - Intronic
907542618 1:55229915-55229937 CAAAAAGGACAGTGTGTGCTTGG - Intergenic
908465318 1:64387853-64387875 GCAAATGGCCAGAAGCTGCTGGG + Intergenic
909213808 1:72859575-72859597 TAAAATGGACAGAGAAAGCTTGG + Intergenic
913168537 1:116211453-116211475 GAAAAAGGAAAGTTGGTGCTGGG - Intergenic
913177962 1:116292271-116292293 GAAAATGGAAGAAGGATGCTTGG - Intergenic
913493406 1:119404364-119404386 GAAAATGGACAATGGGAGGTAGG + Intergenic
913550371 1:119911484-119911506 GAAAATGGAAATAAGATGCTAGG + Intergenic
915989902 1:160503491-160503513 GAACAGGGAAAGAAGGTGCTGGG + Intronic
916750278 1:167717149-167717171 GAACCTGGAGAGAGGGTTCTTGG + Intergenic
919705140 1:200669338-200669360 GAAAATGTACAGGGGGTGGCGGG + Intronic
919921401 1:202168570-202168592 GGAAATGGACAGAGGCCTCTGGG - Intergenic
920043951 1:203121560-203121582 GGAAATGGCCAAAGGGTGATCGG - Intronic
922795154 1:228336135-228336157 GCATAAGGACAGAGGGTGGTGGG + Intronic
922886863 1:229027214-229027236 GACAATGGAGAGAGTGTTCTGGG - Intergenic
1063033684 10:2262906-2262928 TAAGATGGCCAGAGGGGGCTGGG + Intergenic
1063966970 10:11353766-11353788 GAAACTGGAAGGAGGATGCTGGG - Intergenic
1064795832 10:19010117-19010139 GAAATTTGACTGAGGGTGGTCGG - Intergenic
1067284126 10:44895046-44895068 GAAGATGGAATGTGGGTGCTGGG - Intergenic
1068521287 10:58080341-58080363 GAAAGTGGTCAGAGGCTACTGGG + Intergenic
1070706806 10:78645726-78645748 GCCAGTGGAGAGAGGGTGCTGGG + Intergenic
1071437671 10:85662345-85662367 CAAAAGGACCAGAGGGTGCTTGG + Intronic
1071667696 10:87576765-87576787 GGAACTGGAGTGAGGGTGCTGGG - Intergenic
1072401477 10:95106850-95106872 GAAAATGGCCATACGGTGCAAGG - Intergenic
1074626015 10:115187648-115187670 TATAATAGAAAGAGGGTGCTTGG + Intronic
1076315072 10:129534149-129534171 GCAAAGGGACAGAGGGTGGGAGG + Intronic
1077028866 11:454395-454417 GGAAATGGAAAGATGGTGTTGGG + Intronic
1077585207 11:3446272-3446294 GAAAATGCAAGGAAGGTGCTTGG - Intergenic
1078103441 11:8343698-8343720 GAGATTGGAGAGGGGGTGCTGGG - Intergenic
1078181219 11:9012813-9012835 AAAAATGGACAGAGGAGGCTGGG - Intergenic
1078904333 11:15670395-15670417 GAAAAAGGACAAAGTGAGCTTGG + Intergenic
1079312208 11:19377102-19377124 GAAAAAGGACAGAGATTGCTGGG - Intronic
1080062257 11:27969607-27969629 GAAGGAGGACAGAGAGTGCTAGG - Intergenic
1080682584 11:34490297-34490319 GAAAATCTGCAGAGGCTGCTGGG - Intronic
1080898367 11:36464271-36464293 CAATATGGCAAGAGGGTGCTGGG + Exonic
1084242109 11:67828835-67828857 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1084942915 11:72623455-72623477 GATAATGGAGAGAGGGAGCTTGG - Intronic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1086966979 11:93038694-93038716 GAAAATGAATAGAGTGGGCTGGG - Intergenic
1088393520 11:109342128-109342150 GAAAATTGATACATGGTGCTGGG + Intergenic
1088623141 11:111707436-111707458 TAAAAAGGACACAGAGTGCTTGG - Intronic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1090328819 11:125913207-125913229 GAAGCTGGAGAGAGGGAGCTTGG - Intronic
1090393349 11:126403674-126403696 GAAGATGGAGAGAGGGAGCAGGG + Intronic
1090448847 11:126788425-126788447 GAACATGGACAGAGGAGGCAAGG - Intronic
1090550848 11:127818234-127818256 AGAATTGGACATAGGGTGCTGGG + Intergenic
1091131486 11:133150652-133150674 GACACTGCACAGTGGGTGCTGGG - Intronic
1092412358 12:8263534-8263556 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1092976068 12:13746094-13746116 AGAAAGGGACAGAGAGTGCTTGG + Intronic
1094441804 12:30485862-30485884 GCAAAGGGACAGAAAGTGCTGGG - Intergenic
1095585948 12:43849213-43849235 AAAAATGGATGGAGAGTGCTGGG + Intronic
1095833347 12:46610901-46610923 GAAAAAGCACAGTGCGTGCTGGG + Intergenic
1098179042 12:67826324-67826346 AAAAATGGACAGAGGGTTCTGGG - Intergenic
1098431924 12:70429106-70429128 GAAGATTGACAAAGGGTGTTGGG - Intronic
1101709940 12:107255916-107255938 GACAATGGATAGAGGTTTCTGGG + Intergenic
1102998172 12:117365357-117365379 GGAAATGGACAGAGTGTGGCTGG + Intronic
1103989259 12:124787226-124787248 GATAACTGACATAGGGTGCTTGG + Intronic
1104109318 12:125690161-125690183 GAAACAGGACTGAGGATGCTGGG + Intergenic
1104744173 12:131200826-131200848 GAAGATGGAAAGAGGGAGGTGGG - Intergenic
1104790206 12:131476397-131476419 GAAGATGGAAAGAGGGAGGTGGG + Intergenic
1105795592 13:23849042-23849064 AAACATGCACAGAGGGTGTTTGG + Intronic
1105898369 13:24737086-24737108 GAAAATGAACAAAGGATGATGGG - Intergenic
1106952181 13:34896612-34896634 GAACTTGGACTGAGGGTGCTTGG - Intergenic
1107261953 13:38502966-38502988 GAAAGTGGACAGAGGATGCCAGG - Intergenic
1107699685 13:43035214-43035236 GCTAATGGAGGGAGGGTGCTAGG + Intronic
1109097550 13:58137064-58137086 GGAAAAGGACAGTGGGTGATAGG + Intergenic
1109302075 13:60600005-60600027 GAAAAGGCACAGAGGGTGGGTGG + Intergenic
1110273908 13:73621294-73621316 GAAATTGCACACAGGGTACTGGG - Intergenic
1110394506 13:75013871-75013893 GAAGATGCAAAGAGGGTACTGGG - Intergenic
1112530316 13:100195669-100195691 GAAAATAGAAAGAGGTTTCTAGG - Intronic
1113656380 13:112070150-112070172 GAGGATGGACGGAGGGGGCTCGG - Exonic
1114538457 14:23437587-23437609 TAAGATGCACAAAGGGTGCTTGG + Intergenic
1115295335 14:31819838-31819860 GAAAATGGACAGAGAATTCTTGG + Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1116149197 14:41116767-41116789 GACAATGGACTGGGGGTGGTCGG + Intergenic
1117752867 14:58941534-58941556 GACAATGTACAGAGTCTGCTAGG + Intergenic
1117913704 14:60656636-60656658 GATACTGGGTAGAGGGTGCTGGG + Intronic
1117994906 14:61469359-61469381 GAAAATGAACATTGGGTTCTAGG + Intronic
1118370793 14:65135684-65135706 GAATATGCAGAGAGGGTGCCAGG - Intergenic
1119532620 14:75373645-75373667 GAAAATGAACAGAAATTGCTAGG - Intergenic
1120445097 14:84585532-84585554 GCAAATGGGCAGAGTGTACTAGG + Intergenic
1120853865 14:89196062-89196084 GAAAATTGAAATAGGCTGCTGGG - Intronic
1121117897 14:91356434-91356456 GAAACTGGACAGTGAGGGCTGGG - Intronic
1121660310 14:95630414-95630436 GAAAATGTACAGTGTGGGCTCGG + Intergenic
1122345422 14:101055660-101055682 GAAAATCGAGAGAGGTTGTTGGG + Intergenic
1122364192 14:101184530-101184552 GAAAATGGACAAAGGCTCCAAGG - Intergenic
1122500706 14:102197309-102197331 AAGAATGGACAGAGAGTACTGGG + Intronic
1123068177 14:105628485-105628507 AAACCTGGACAGAGGGTGCCAGG - Intergenic
1123072184 14:105647264-105647286 AAACCTGGACAGAGGGTGCCAGG - Intergenic
1123092191 14:105746781-105746803 AAACCTGGACAGAGGGTGCCAGG - Intergenic
1123097767 14:105774482-105774504 AAACCTGGACAGAGGGTGCCAGG - Intergenic
1123587526 15:21772879-21772901 GAAAGGGGACAGAGGGGGCGGGG + Intergenic
1123624164 15:22215444-22215466 GAAAGGGGACAGAGGGGGCGGGG + Intergenic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1124897229 15:33788520-33788542 TAAAATGGAAAGATGGTGTTGGG + Intronic
1126102250 15:45125915-45125937 GAAAATGTCCACAGGGTGGTTGG - Intronic
1126957487 15:53950159-53950181 TAAAATGCAAAGAGGGGGCTTGG + Intergenic
1127354990 15:58189501-58189523 GAAAGTGGGTAGAGGGTGATGGG - Intronic
1131838421 15:96412734-96412756 GAAGATGGACAGGGGCTGATGGG - Intergenic
1132334892 15:101041656-101041678 GCAAGAGTACAGAGGGTGCTGGG - Intronic
1133911569 16:10070836-10070858 GACAAAGGAAAGAGGGTACTTGG - Intronic
1136160024 16:28413912-28413934 GGAACTGGACAGGGGCTGCTGGG + Intergenic
1136203064 16:28701380-28701402 GGAACTGGACAGGGGCTGCTGGG - Intronic
1138595194 16:58025966-58025988 GGGCATGGACAGAGGGAGCTGGG + Exonic
1138600020 16:58048637-58048659 GGAGGTGGACAGAGGATGCTGGG + Intergenic
1140034041 16:71359412-71359434 GAAAATGGACAAAGGAAGCAGGG - Intronic
1140306233 16:73805808-73805830 GTAAAGAGACAGAGGGTGATGGG + Intergenic
1140844907 16:78877536-78877558 GAAAAGGAAGAGAGGGTGCAAGG - Intronic
1140911262 16:79455121-79455143 GGAAATGGACAAAGGGTGGAGGG - Intergenic
1141079057 16:81035133-81035155 GTAAATGGACATAGGAGGCTGGG - Intergenic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1144459529 17:15447012-15447034 GAAAATCCACAGTGGGTCCTGGG - Intronic
1145372347 17:22317487-22317509 GAAAATGGTCACAGTTTGCTGGG + Intergenic
1146249737 17:31328618-31328640 GAAAAGGGAGAAAGGGTGCAAGG - Intronic
1146286026 17:31574684-31574706 GAAATGGGAGAGAGGGTGGTGGG + Intronic
1147913897 17:43875470-43875492 GAATATGGACAGTGGATGGTAGG + Intronic
1148738285 17:49877316-49877338 TAAAGTGCCCAGAGGGTGCTGGG + Intergenic
1148848227 17:50541383-50541405 GGAAGAGGACAGAGGCTGCTCGG - Intronic
1150335037 17:64324841-64324863 GAAAGTAGACAGTGGTTGCTAGG + Intronic
1152024156 17:77797873-77797895 GAACATGGACAGAGTGTGGGGGG - Intergenic
1152771624 17:82173106-82173128 GAAAGTGGAATGGGGGTGCTGGG + Intronic
1153705802 18:7744469-7744491 TAAAATGCACTGAGAGTGCTGGG - Intronic
1156353855 18:36323977-36323999 GAAAATCAACAGAGAATGCTGGG - Intronic
1156787736 18:40935899-40935921 GAGAATGGACAGCAGGTGGTAGG + Intergenic
1157286817 18:46382631-46382653 GACAATAGACAGAGGATGGTTGG - Intronic
1157824321 18:50799207-50799229 GTAATGGGAAAGAGGGTGCTGGG - Exonic
1163510280 19:17730609-17730631 AAAAATGGGCAAAGGGGGCTAGG - Intronic
1164474183 19:28562532-28562554 GGAAAAGGACAGAGAGTGATTGG - Intergenic
1166197241 19:41215263-41215285 AAAGATGGACAGGTGGTGCTGGG - Intergenic
1167220242 19:48194605-48194627 GAAAGAGGTCAGAGGATGCTGGG - Intronic
925324517 2:3007519-3007541 GAGAATGGAGAGATGGCGCTGGG + Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
926682193 2:15672544-15672566 TAAAATGGTCAGAGGGGCCTGGG - Intergenic
927632599 2:24787402-24787424 GAAAATAGCCAGTGGGTTCTAGG - Intergenic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
928247634 2:29644961-29644983 GAGAATTGACATTGGGTGCTTGG - Intronic
928808050 2:35185698-35185720 GAAAATGGACAAAGATTGCAAGG - Intergenic
929826141 2:45310787-45310809 GAGGATGGACTGAGGGGGCTCGG - Intergenic
929826167 2:45310885-45310907 GAAAATGGACTGAGGGGACCCGG - Intergenic
929826194 2:45311007-45311029 GAAAATGGACTGAGGATACTCGG - Intergenic
929826200 2:45311032-45311054 GAAAATGGACTGAGGGGACTCGG - Intergenic
929826240 2:45311227-45311249 GAGAATGGACTGAGGGGACTTGG - Intergenic
929826275 2:45311374-45311396 GAAAATGGACTGAGGGGACTCGG - Intergenic
929826283 2:45311399-45311421 GAGAATGGACTGAGGGGACTTGG - Intergenic
930804120 2:55472995-55473017 GAAAATGGGCAAAGCGGGCTGGG + Intergenic
931991712 2:67796977-67796999 GGAAATGGACACAAGGTGTTGGG - Intergenic
932423858 2:71616999-71617021 GGAAATGGACAGGGGGTGGCAGG - Intronic
932573882 2:72952189-72952211 GAAAATGGACAGCAGTTGATGGG - Intronic
932625861 2:73295324-73295346 GATAATGGACATAGGGTGAAAGG - Intergenic
934603010 2:95672524-95672546 GAGAATGGACAGGGGATGCAGGG + Intergenic
934756699 2:96829217-96829239 GAAAAAAGACAGAGGGTGGGGGG - Intronic
936084573 2:109457974-109457996 GAGAAAGAACAGAGAGTGCTGGG + Intronic
936536394 2:113314721-113314743 GAGAATGGACAGGGGATGCAGGG + Intergenic
937234905 2:120424962-120424984 GATGATGGGGAGAGGGTGCTGGG + Intergenic
937335891 2:121062203-121062225 GTTCATGGAGAGAGGGTGCTGGG - Intergenic
938075040 2:128327459-128327481 GAGGATGGTCGGAGGGTGCTTGG - Intergenic
938113259 2:128584683-128584705 GGAAATGTTCAGAGTGTGCTTGG + Intergenic
938736492 2:134191088-134191110 GAAAAAGAACAGACGGTGCCAGG - Intronic
938797173 2:134727537-134727559 GAAACCGGTCAGAGGTTGCTAGG + Intergenic
939884953 2:147671477-147671499 GATAATCCACATAGGGTGCTTGG - Intergenic
941121899 2:161540087-161540109 GAAAATGGCCATAGGGTCCAAGG + Intronic
941677334 2:168357517-168357539 GAAATTGGAAACAGGCTGCTGGG + Intergenic
941875293 2:170426183-170426205 GAAGATAAACAGGGGGTGCTGGG + Intronic
947698321 2:232211439-232211461 GAAAAGGGATTGGGGGTGCTGGG - Intronic
949052635 2:241905286-241905308 GAAAAGGGGGAGTGGGTGCTGGG + Intergenic
1169585410 20:7077949-7077971 GAAAAAGAATAGAGGGTGTTAGG - Intergenic
1169994387 20:11540754-11540776 GAAACTGGACAAAGGGTGACAGG + Intergenic
1171370828 20:24661159-24661181 GAAAATAGGCAAAGGCTGCTGGG + Intronic
1171814717 20:29775461-29775483 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1172499924 20:35418459-35418481 AAAGATGGGCAGAGGGAGCTTGG - Intergenic
1173012954 20:39199171-39199193 GAAAAATGGCAGAGGGTGCATGG + Intergenic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1175196470 20:57247000-57247022 AAAAGAGGACAAAGGGTGCTTGG + Intronic
1176229262 20:64023451-64023473 GAGGACGGACAGAGGGTGCGTGG - Intronic
1176263550 20:64196333-64196355 GTAGATGGAGAGCGGGTGCTGGG - Intronic
1178013956 21:28320498-28320520 GAATATGGACAAAGGGTGCATGG - Intergenic
1178944526 21:36935822-36935844 GAAAATGGAAAGAGGATGAAAGG - Intronic
1180078812 21:45477080-45477102 GAAAAGGGACAAAGCATGCTGGG + Intronic
1180276939 22:10651988-10652010 GATAATGGACACAGAGTTCTTGG - Intergenic
1181163899 22:20973510-20973532 GAGAATGGCCAGTGGGTTCTGGG + Exonic
1182597783 22:31435450-31435472 CAATATGGACGGAGGGGGCTGGG + Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1183278049 22:36913750-36913772 GAAAAAGGACAGGGGGAGCCTGG + Intronic
1183290258 22:36997646-36997668 GAGAATGGACATAGGGAGATGGG - Intronic
1184105954 22:42367747-42367769 GCAAAGGGACAGAAGGTGATGGG + Intergenic
1184508303 22:44917329-44917351 GAAAATGCACAGGAAGTGCTGGG + Intronic
1184709889 22:46243398-46243420 GAAGTTGGAGAGAGGATGCTGGG - Exonic
1185062698 22:48615424-48615446 GAACACGGACAGAGCGTCCTCGG - Intronic
952909609 3:38171151-38171173 GAAAATGGAGAGAGGCTGTCAGG - Intronic
954601537 3:51874400-51874422 GAAAATGGAATGAGGTAGCTAGG - Intronic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
955484069 3:59418059-59418081 GAAAATGGATGGTGGGTGGTGGG - Intergenic
956325137 3:68043962-68043984 GATAATGGGCAGGGGGTTCTAGG - Intronic
957068259 3:75544382-75544404 GAAAATGAACTGTGGGTACTTGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959535693 3:107482548-107482570 ATAAAAGGACATAGGGTGCTTGG - Intergenic
961589864 3:127970773-127970795 GAAAATGGAGAAAGGGTGAATGG + Intronic
961889919 3:130122196-130122218 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
963088176 3:141457364-141457386 GAAAAGGGACAGAGAGTGAGGGG - Intergenic
964411789 3:156405359-156405381 GAAGATGGACACAGAGGGCTGGG - Intronic
968079193 3:195834908-195834930 GAAAATGTGCCGGGGGTGCTGGG + Intergenic
968185982 3:196633932-196633954 GAAAATGGGCACGCGGTGCTGGG - Intergenic
969117541 4:4880890-4880912 GAGAATGGTGAGAGGGTACTTGG - Intergenic
969415602 4:7055873-7055895 GAAAATGGACTGAGAGGGCCTGG - Exonic
969753621 4:9132493-9132515 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
969813517 4:9668676-9668698 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
971610540 4:28719841-28719863 GAAATAGAACAGAGGTTGCTCGG - Intergenic
981701725 4:147614759-147614781 TAAAATTGGCAGATGGTGCTAGG - Intergenic
984858591 4:184217191-184217213 GAAAAGGGACAGAAGGAGTTTGG + Intronic
985147623 4:186909828-186909850 GAAAAAGAACAGATGGTGATAGG + Intergenic
985541500 5:489568-489590 GACACTGGCCAGAGGCTGCTGGG - Intronic
987212123 5:15693761-15693783 GAAATTTGGCAGAGGGTGGTTGG + Intronic
992453186 5:76891748-76891770 GTAGATAGACAGAGGGTGCAGGG + Intronic
992778128 5:80105769-80105791 GAAATTGGACAAAGTGTTCTGGG - Intergenic
993799437 5:92313713-92313735 GAACATGGAGAGAGAGAGCTTGG - Intergenic
995601063 5:113796718-113796740 GAAACTGGACAGATGGTGGTGGG + Intergenic
997059642 5:130486146-130486168 AAAAATAGACAGGGAGTGCTAGG + Intergenic
997498585 5:134352594-134352616 AAAAATGGGCAAAGGTTGCTGGG - Intronic
998152501 5:139765313-139765335 TAAACTGGAAAGAGGGCGCTGGG - Intergenic
998214754 5:140228752-140228774 GAAGATGGACAGCGGGTGTCAGG + Intronic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
999208346 5:149866502-149866524 GAAAAAGGCCAGAGGGTGGGAGG + Intronic
999770233 5:154770103-154770125 GAAAATGGACAGAGGAGGTAGGG + Intronic
1000189671 5:158897933-158897955 GACAATGCACAAAGGGTACTGGG + Intronic
1000770403 5:165346293-165346315 GAAGATGGAAAGATGGTTCTGGG + Intergenic
1000992646 5:167926872-167926894 GAAACTGGACAAAGAGTACTTGG + Intronic
1001110630 5:168893359-168893381 GAAAAGGGACAGAGGGGGTGGGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001975992 5:175999119-175999141 GCAAATGGAAAGAGGGAGCAAGG + Intronic
1004221575 6:13751993-13752015 GAAATTGGAGAGAGGGGGCTGGG - Intergenic
1004924000 6:20402092-20402114 GAAAAGAGAGAGAGGGGGCTCGG + Intronic
1005219187 6:23566546-23566568 GTAAATGGACAGATGGTTCATGG + Intergenic
1005808994 6:29502158-29502180 GGAAATGGAAAGAAGGAGCTGGG + Intergenic
1006112741 6:31758497-31758519 GGAACAGGACAGAGGGTGCCAGG + Intronic
1007321364 6:41030901-41030923 GACAGTGGGTAGAGGGTGCTGGG - Intronic
1007485289 6:42176870-42176892 GTAAAATGACAGAGGGTGTTTGG + Intronic
1008606835 6:53148818-53148840 GAAAATGACCAGAGCCTGCTGGG - Exonic
1009298771 6:61988557-61988579 GAAAATGGGGAGTAGGTGCTGGG + Intronic
1011017213 6:82770144-82770166 GATAATGGACAGTGGGTGAAAGG + Intergenic
1012200544 6:96400842-96400864 GAAAAGGGACTGAGTTTGCTGGG + Intergenic
1013583691 6:111560149-111560171 GAAAGGGGACAGGGAGTGCTGGG + Intronic
1013698050 6:112727839-112727861 GGAAATGGATGGTGGGTGCTAGG + Intergenic
1015225700 6:130854497-130854519 AAAAATGAACATAAGGTGCTAGG + Intronic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1016544228 6:145202520-145202542 GAAAATGGAAAGAGGAAGCATGG + Intergenic
1018001235 6:159580492-159580514 GCAAGTGGACAGAGGGCGATGGG + Intergenic
1019198252 6:170295040-170295062 GAGAATGGGCAGAGGGTGGTTGG - Intergenic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1023956172 7:44888553-44888575 AGAAATGAACAGAGGGGGCTGGG - Intergenic
1023965156 7:44960293-44960315 GGAAATGGGCAGATGCTGCTGGG + Intergenic
1027399880 7:77796688-77796710 GAAAAAGATCAGAAGGTGCTAGG + Intronic
1028703653 7:93813146-93813168 GAATTTAGACAGAGGATGCTGGG - Intronic
1029071260 7:97900576-97900598 GAAAATGAACTGTGGGTACTTGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031805873 7:126305307-126305329 GAAAAGGGGCAGAGAGTTCTAGG - Intergenic
1032380194 7:131471349-131471371 GAAAATGAAGAGAGGTTGGTGGG + Intronic
1032581404 7:133106473-133106495 GGAAATGTACCGAGGGTGCCAGG - Intergenic
1033591823 7:142815105-142815127 GAAAGTGGACAGTGGGTGGTGGG + Intergenic
1033872855 7:145777908-145777930 GAAAATGGGTAGGGGGTGGTAGG - Intergenic
1034889768 7:154829512-154829534 GAAAATGGAGAGAGGGAGGAAGG + Intronic
1035555131 8:562305-562327 GCAGGTGGACAGAGGGTGGTGGG + Intergenic
1035677963 8:1468290-1468312 CAGAATGGACCGAGGCTGCTGGG - Intergenic
1035677976 8:1468360-1468382 CAGAATGGACTGAGGCTGCTGGG - Intergenic
1036251966 8:7170166-7170188 ATAAATGGAGAGAGGGAGCTCGG - Intergenic
1036365524 8:8117295-8117317 ATAAATGGAGAGAGGGAGCTCGG + Intergenic
1036376834 8:8207825-8207847 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
1036852703 8:12215312-12215334 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1036874074 8:12457834-12457856 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1036887824 8:12572594-12572616 GAAAATGAACTGTGGGTACTTGG + Intergenic
1037368149 8:18144766-18144788 GAAAGTGGGCAGAGGGTGCCAGG - Intergenic
1037479715 8:19293030-19293052 GAAAATGGACAGAATGGGCCAGG - Intergenic
1038974950 8:32684992-32685014 GAAAATGGACAAAGGGTACAGGG - Intronic
1039660047 8:39451576-39451598 GGAAATGCACAGAGGGTTTTTGG - Intergenic
1040727093 8:50394362-50394384 GAAAATGGAGAGAGGAGGATGGG + Intronic
1041170820 8:55140697-55140719 GAGCATGGCCTGAGGGTGCTTGG + Intronic
1041197812 8:55418584-55418606 GAAAATGGACTGAGGGGACAGGG - Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042386969 8:68187893-68187915 GGAGGTGGACAGAGGGGGCTGGG + Intronic
1043163679 8:76876360-76876382 GAAAATAGATAGTGGGTGCCAGG - Intergenic
1043595505 8:81880729-81880751 GAAAATGGAAAGAGCAGGCTGGG + Intergenic
1045837033 8:106534827-106534849 GAAAATGGAAAGAGGTTAATAGG + Intronic
1048163590 8:132042264-132042286 CAAGATAGACAGAGGCTGCTGGG + Intronic
1049228284 8:141468105-141468127 GGAGATGGACAGAGGGTGTCAGG - Intergenic
1049582110 8:143417532-143417554 GAAAATAGACAGGGGAGGCTGGG + Intergenic
1050424413 9:5498961-5498983 GAAAATGGGGAGAGGGGGCCGGG - Intergenic
1050584669 9:7098229-7098251 AAAAATGGACAGAGGTGGCCAGG - Intergenic
1051358835 9:16264275-16264297 GGCAATGGACAGGCGGTGCTGGG - Intronic
1051737502 9:20216387-20216409 GAAAATGGTTGGAGGGAGCTAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053210098 9:36220319-36220341 AAAGATGGACAGTGTGTGCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054878037 9:70116889-70116911 GAAAATAGAGAGAGGGAGATGGG - Intronic
1056037128 9:82618471-82618493 GAAAATGAACAGAGGGTCTTTGG + Intergenic
1056306882 9:85299249-85299271 GAAATTGGAGATAGGGTGTTAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057787346 9:98096811-98096833 GAAGATGGACAGAGGAGGCCAGG - Intronic
1058873155 9:109219647-109219669 GAAAATGGACAAAGGTGGCCAGG - Intronic
1058898226 9:109418382-109418404 ATAAAGAGACAGAGGGTGCTGGG + Intronic
1059125338 9:111679366-111679388 GTAAATGGATAGAGGATGGTGGG + Intergenic
1059299460 9:113300486-113300508 GAAAATGGGCTTCGGGTGCTTGG + Intronic
1059434013 9:114265740-114265762 GAAAATGTATAGGGAGTGCTTGG + Intronic
1059801739 9:117756589-117756611 TGATAGGGACAGAGGGTGCTAGG - Intergenic
1060980786 9:127790460-127790482 GAAAGTGGGCAGAGGGTGAAGGG + Exonic
1203366388 Un_KI270442v1:261774-261796 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1187950842 X:24468533-24468555 GTAAATGGTCTGGGGGTGCTGGG + Intronic
1189256890 X:39646960-39646982 GAAAATGAATAAAGGGTGGTTGG + Intergenic
1189304557 X:39977144-39977166 GAAAATGATCAGTGGCTGCTTGG + Intergenic
1189398542 X:40645088-40645110 GCAGGAGGACAGAGGGTGCTGGG + Intronic
1189467627 X:41289211-41289233 GAGAATGGGCAGAGGTTGCTGGG + Intergenic
1189586955 X:42471698-42471720 GAAAATGGATAGATGGTACATGG + Intergenic
1189907223 X:45773813-45773835 CAAAATGAAGAGAGGGTGGTTGG + Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192482678 X:71499030-71499052 GCAAAAGGACTGAGGGTGCCTGG - Intronic
1194041046 X:88942386-88942408 GTAAATGGACAGAAATTGCTGGG - Intergenic
1196445849 X:115845664-115845686 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196446520 X:115848645-115848667 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196449199 X:115860579-115860601 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196451209 X:115869530-115869552 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196451880 X:115872513-115872535 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1197288677 X:124627575-124627597 GGACATGGACAGAGGTGGCTCGG - Intronic
1199273150 X:145909393-145909415 GGAAATGAACAGTGGGTGATGGG + Intergenic
1200061299 X:153484971-153484993 GAACATGGAGAGAGGGAGCAGGG - Intronic
1201072301 Y:10158457-10158479 AAAAATGAACAGAGGTGGCTGGG + Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic