ID: 1174449140

View in Genome Browser
Species Human (GRCh38)
Location 20:50609126-50609148
Sequence CACCAGGCTCAGAGAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174449128_1174449140 17 Left 1174449128 20:50609086-50609108 CCATCATGATGGAAAATGGACAG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1174449140 20:50609126-50609148 CACCAGGCTCAGAGAGGGGTGGG 0: 1
1: 0
2: 2
3: 32
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174449140 Original CRISPR CACCAGGCTCAGAGAGGGGT GGG Intronic
901026206 1:6279935-6279957 CTCCAGGCTCTGAGAGGAATGGG + Intronic
901131672 1:6965490-6965512 CCCCTGGCTCAGAGGGGGCTGGG + Intronic
901261630 1:7875802-7875824 CCCCAGGCTCAGGGACTGGTGGG - Intergenic
901403638 1:9031786-9031808 CTCCAGTCTCGGAGAGGGGTTGG - Intergenic
901457028 1:9368829-9368851 CTTGAGGCTCTGAGAGGGGTTGG - Exonic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
902927268 1:19704386-19704408 AAACAGGGTCAGAGAGGGGATGG + Intronic
903141572 1:21342351-21342373 CAGCAGGCACAGAGAGGTGAAGG - Intronic
903213032 1:21829205-21829227 CCCATGGCTCAGAGAGGGCTAGG + Intronic
903549758 1:24149746-24149768 AAACAGACTCAGAGTGGGGTGGG + Intergenic
903660304 1:24973045-24973067 ACTCAGGCTCAGAGAGGGGCAGG + Intergenic
903668863 1:25023870-25023892 CCCAAGGCTCAGAGATGGGCTGG + Intergenic
903670749 1:25034103-25034125 TCCCAGGCTCAGAAAGGGGAAGG + Intergenic
903708909 1:25307228-25307250 CCTGAGGCCCAGAGAGGGGTGGG + Intronic
903931116 1:26863091-26863113 GGCCAGGCCCAGAGAAGGGTGGG - Intergenic
904565161 1:31424481-31424503 CTTCAGGCCCAGAGAGGGCTAGG + Intronic
905696900 1:39981119-39981141 CTCCAGGCTCAGAGAGGACAAGG + Intergenic
905777193 1:40676232-40676254 ACCGAGGCTCAGAGAGGGGCAGG - Intergenic
905860069 1:41344458-41344480 TACCAGGCACAGGGAGGGGCTGG - Intergenic
905884888 1:41486345-41486367 CACGAGGCTCAGAGAGGAGCAGG + Intergenic
905948447 1:41924218-41924240 CACCAGGAGCAGAAAGAGGTAGG + Intronic
906519185 1:46457265-46457287 CCCCAGACTCCGTGAGGGGTTGG - Intergenic
906523139 1:46478955-46478977 CACTAGGCTCAGAGAGGGCCAGG - Intergenic
909115295 1:71526532-71526554 CACCACCCACAGAGAGAGGTGGG + Intronic
911958775 1:104271851-104271873 CACCAGGCCCAGTCAGGGGGTGG - Intergenic
914021179 1:143869325-143869347 TATCAGGCTCAGAGAGGCATTGG + Intergenic
915079716 1:153343852-153343874 GCTCAGGCGCAGAGAGGGGTGGG + Intronic
915226306 1:154414338-154414360 CACCAGGCACAGGGTGGGGCAGG - Intronic
915287428 1:154861867-154861889 AACGAGGCCCAGAGAGGGGAAGG + Intronic
915464748 1:156090388-156090410 CAAAAGGCAGAGAGAGGGGTGGG + Intronic
915714035 1:157927332-157927354 CACCAGGCTCAGAAAGTTTTTGG - Intergenic
917459249 1:175214900-175214922 CACCATGGTGAGAGATGGGTTGG + Intergenic
917535328 1:175870465-175870487 CTGCAGGCTTAGAGAGGAGTAGG + Intergenic
920031506 1:203040159-203040181 AACCAGACCCAGAGAGGGCTGGG + Intronic
920628390 1:207626655-207626677 CACCAGGCCTAGAGAGGTGCAGG + Intronic
921184175 1:212655921-212655943 CACCAGGCCATAAGAGGGGTTGG - Intergenic
921902283 1:220463380-220463402 CTCCAACCTCAGAGTGGGGTTGG + Intergenic
922210093 1:223479742-223479764 TCCCAGCCTCAGAGAGGGGCCGG + Intergenic
923142337 1:231171255-231171277 CACCTGGCCCAGAGATGGGCAGG + Intronic
923285581 1:232491737-232491759 TACCAGAGTCAGAGAGAGGTTGG - Intronic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
923836432 1:237616103-237616125 GACCATGCTCAGAGGAGGGTGGG + Intronic
924239275 1:242025592-242025614 CACAAGGCACTGTGAGGGGTTGG + Intergenic
924800822 1:247328909-247328931 CACCAGGCCCAGGGAGAGATGGG - Intronic
1063159874 10:3411477-3411499 CACCTGGTTCTGAGAGGGGCTGG - Intergenic
1066441372 10:35442384-35442406 CATCAGGCTCATAGTGTGGTGGG + Intronic
1067549446 10:47223537-47223559 CACCAGGCTCAGTGGGGGCAGGG + Intergenic
1067560750 10:47302779-47302801 GACCAGGGTCTGGGAGGGGTAGG + Intronic
1069338166 10:67378094-67378116 CACTAGGGTCTGAGAAGGGTAGG - Intronic
1069628284 10:69881402-69881424 CGCCGTGCTCAGTGAGGGGTGGG + Intronic
1070247877 10:74748993-74749015 CACCAGGCACTGAGACGGGCAGG - Intergenic
1070331047 10:75417577-75417599 CACCTGGCTCAGAGTGAGGAGGG - Intergenic
1070440211 10:76435709-76435731 TGCCATGCTCATAGAGGGGTTGG + Intronic
1070776443 10:79112599-79112621 GACGAGGCCCAGAGAGGGGAAGG + Intronic
1071396110 10:85225618-85225640 CACCACACTCAGAGATGGATTGG - Intergenic
1073568624 10:104557033-104557055 CACCAGGATCAGAGAGGCCCAGG + Intergenic
1074230981 10:111534885-111534907 TACCAGGCCCAGAGAGGCATTGG - Intergenic
1074675629 10:115847200-115847222 CACCAGGGACAGGGAGGGGGAGG + Intronic
1075686303 10:124367469-124367491 AAACAGGCTCAGAGAGGGCCAGG + Intergenic
1076120687 10:127934721-127934743 CCCCAGGCACAGAGCGGGGAAGG - Intronic
1076800761 10:132827040-132827062 CACGAGGCTCATGGAGGTGTCGG - Intronic
1077219020 11:1407220-1407242 CACCAAGCTCAGAGAGGGCAGGG - Intronic
1079027658 11:16961538-16961560 CTCCAGGCACAGCCAGGGGTGGG - Intronic
1079111545 11:17607914-17607936 CACCAGGGTCCCAGAGGGGCAGG + Intronic
1081698549 11:45136812-45136834 CACCAGGCACTGAGGAGGGTGGG + Intronic
1081718920 11:45272180-45272202 CACCAGGGTCTGTCAGGGGTGGG + Intronic
1082602337 11:55173325-55173347 CACCTGGCTCAGAGAGTCCTAGG - Intergenic
1083300750 11:61738591-61738613 CCCTAGGCTCAGGGAGGGCTGGG + Intronic
1083317582 11:61826153-61826175 CAGCAGCCTCAGTAAGGGGTAGG - Intronic
1084174617 11:67416757-67416779 CGCCAGCCTCAGAGAGGGGAGGG + Intronic
1085399749 11:76228777-76228799 ACCCAGGCTCAGAGAGGGGCAGG + Intergenic
1085512432 11:77095206-77095228 CTCAAGGCCCAGAGAGGGCTGGG + Intronic
1086157390 11:83682558-83682580 CACCCAGCTCAGTGAGGAGTAGG + Intronic
1089577824 11:119459371-119459393 CAGTAGGCAGAGAGAGGGGTTGG + Intergenic
1089623147 11:119734315-119734337 CTCCAGGCTCAGAGAAAGATGGG - Intergenic
1091236871 11:134028022-134028044 CACCAGGCACAGAGAGCTCTGGG - Intergenic
1091276721 11:134357766-134357788 CAGCAGCCTCAGAGAGAGGCTGG - Intronic
1091572132 12:1696313-1696335 CACCAGTCTCAGTGAGGAGGAGG - Intronic
1091746358 12:2995393-2995415 CACCAGGCACACAGAAGGCTCGG - Intronic
1091784960 12:3237724-3237746 CCCCAGGCACAGAGAGGGCAGGG + Intronic
1099217179 12:79867304-79867326 CACCAGGGTCTGTGGGGGGTGGG + Intronic
1101788562 12:107908293-107908315 TACCTGCCTCAGAGAGTGGTAGG - Intergenic
1101843799 12:108345975-108345997 GACCAGGCTCAGAGAAGGAGGGG + Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102471810 12:113163590-113163612 GGCCAGGCGCAGAGAGGGGCAGG - Intronic
1102544678 12:113645962-113645984 TGCCAGGCTCAGAGAGACGTCGG - Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102650871 12:114441519-114441541 CTCCAGGCCCAGAGAGGGGAAGG + Intergenic
1103040102 12:117687908-117687930 ACCCAGGCTCAGAAAGGGGCAGG - Intronic
1103402521 12:120652953-120652975 CACCAGGCTCAGAGCTGGGCAGG + Intronic
1103907487 12:124335065-124335087 CACCAGGCCTGGAGAGGGGATGG - Intronic
1104599507 12:130142922-130142944 CAGCAGGCTCCGAGCAGGGTTGG - Intergenic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1105459776 13:20573088-20573110 TACCAGGTCCAGAGAGGCGTGGG + Intronic
1105546914 13:21357459-21357481 AACCAGACTCGGAGATGGGTGGG - Intergenic
1105836188 13:24214077-24214099 CACCAGGCTCAGTCAGAGATTGG - Intronic
1106220810 13:27744846-27744868 CCCTAGGCTCAAAGAGGGATGGG + Intergenic
1106544842 13:30721477-30721499 CACAAGGCTTAGTGAGGGGTTGG - Intronic
1113072490 13:106435042-106435064 CGCCAGGCTCAGTGAGTGGATGG - Intergenic
1113635508 13:111916443-111916465 CACCAGCCTCAGTGTGGGGCTGG + Intergenic
1113881947 13:113631959-113631981 CACCAGACACAAAGCGGGGTGGG - Intronic
1114379209 14:22183323-22183345 CACCTGGCTCAGAAAGGCGTTGG - Intergenic
1114567793 14:23645241-23645263 CACTCGGCTCTGAGAGGAGTGGG + Exonic
1120039770 14:79739354-79739376 CACCATGCCCAGTGAGGGCTGGG - Intronic
1121537240 14:94699315-94699337 GACTAGTCTCAGAGAGGGGAAGG + Intergenic
1121625528 14:95383133-95383155 CTCCAGGCTCAAAGATGGGGTGG + Intergenic
1122145755 14:99688018-99688040 CAGAGGGCACAGAGAGGGGTGGG - Intronic
1122259150 14:100502216-100502238 CATCAGGCTCAGAGCTGAGTGGG - Intronic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1122924026 14:104891648-104891670 CACCTGGCTGAGAAGGGGGTGGG + Intronic
1124490048 15:30150042-30150064 CACCAGGTGCAGACAGGGGAGGG - Intergenic
1124753484 15:32388285-32388307 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1124975226 15:34523988-34524010 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1125200217 15:37096132-37096154 CCCCAGGCTCAGGGATGGGGAGG + Intronic
1126185782 15:45829522-45829544 CTCCATTCTCAGAGCGGGGTTGG - Intergenic
1126837133 15:52679018-52679040 CCCCAGGCTCCGAGAGGCGCAGG + Intronic
1127723954 15:61729184-61729206 CACCAGCCTTGGAAAGGGGTAGG + Intergenic
1128684782 15:69675725-69675747 CACCAGGCTGAGTGAGGGAGTGG + Intergenic
1129692564 15:77722036-77722058 CTGCAGGTGCAGAGAGGGGTGGG - Intronic
1130960834 15:88657705-88657727 GCTAAGGCTCAGAGAGGGGTTGG + Intergenic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1131983185 15:98016146-98016168 CACCTGGCTAAGGGAGGGGCTGG - Intergenic
1132459252 16:42267-42289 CAGCAGGCTGTGAGAGGGGAAGG + Intergenic
1132505532 16:306652-306674 GACGAGGCTCAGAGAGAGGCTGG + Intronic
1132677116 16:1125408-1125430 CTCCAGGCTCAGGGGGTGGTAGG - Intergenic
1133041902 16:3065350-3065372 CACCAGCCTGAGAGTGGGGAGGG - Intronic
1133279307 16:4656040-4656062 CACCAAGCTCAGAAATGGGATGG - Intronic
1133922189 16:10163286-10163308 CACCAGGCTCAGAAGGTGGAAGG + Intronic
1134128561 16:11632874-11632896 TAGGAGGCTCAGAGTGGGGTGGG - Intronic
1134674562 16:16080631-16080653 CCCCAGGCTCAAAGAAGCGTGGG + Intronic
1134816679 16:17211600-17211622 TCCCAGGCTCAGAGAGGGTGAGG + Intronic
1135057878 16:19245461-19245483 CACCAGGCGCCGAGAAGGGCAGG + Intronic
1135560933 16:23476297-23476319 CACCAGGCTCAGGCAGAAGTGGG - Intronic
1136019011 16:27428232-27428254 TACAAGGCTCAGAGAGGGCAAGG + Intronic
1137601985 16:49762457-49762479 CACCAGCCTCACAGAGAGGTTGG - Intronic
1138030569 16:53556443-53556465 CACCAGCCTCAGTGAGGAGGGGG - Intergenic
1138161261 16:54756858-54756880 AATGAGGCTCAGAGAGAGGTTGG - Intergenic
1138529931 16:57629491-57629513 GGCCAGGCTCAGGGAGGGGGTGG + Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1139559176 16:67730772-67730794 CAGCAGGCTTGGAGAGGGGTAGG + Intronic
1140997801 16:80278068-80278090 CACCAGTATCAGAGAGGACTTGG + Intergenic
1141173564 16:81705313-81705335 AACCCGGTTCAGAGAGGCGTGGG + Intronic
1142001644 16:87667647-87667669 TTCAAGGCCCAGAGAGGGGTGGG - Intronic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142227959 16:88886568-88886590 ATGCAGGCTCAGAGAGGGGGAGG + Intronic
1142266923 16:89068196-89068218 CAGGAGGCTCTGAGAGGGGTCGG + Intergenic
1142473414 17:176077-176099 AATGAGGCTCAGAGAGGGGAGGG + Intronic
1142595537 17:1028027-1028049 CGACAGGCTCTGTGAGGGGTGGG + Intronic
1143101974 17:4509524-4509546 CACCAGGGTGAGGGAGGTGTGGG + Intronic
1143295118 17:5865320-5865342 CACCAGGGTCAGAGAGCTCTGGG + Intronic
1143850990 17:9811885-9811907 CACCAGGATCAGACTGGGGGCGG - Intronic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1145005520 17:19335601-19335623 CCCTAGGCTAAGACAGGGGTGGG + Exonic
1145157736 17:20554077-20554099 CACCAGGGTGGGGGAGGGGTGGG - Intergenic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1146305266 17:31725549-31725571 CACCAGGACCAGAGAGGAGAAGG + Intergenic
1146577235 17:34005257-34005279 CACCAGGATGAGAAAGGGGTTGG - Intronic
1146816072 17:35943573-35943595 ACCCAGGGTCAGAGAGGGATGGG - Exonic
1148093591 17:45037323-45037345 CACCAGCCTCAGAGAGATGGAGG - Intronic
1148584432 17:48767365-48767387 CACCATGCTCAGAGAAGAGCTGG - Intronic
1149515606 17:57278647-57278669 CACCAAGCTCACCAAGGGGTTGG - Intronic
1149845368 17:60006430-60006452 CACCAGGCTGGGGGAGGTGTGGG - Intergenic
1150573057 17:66405041-66405063 CGCCCGGCCAAGAGAGGGGTAGG + Intronic
1151401915 17:73861323-73861345 CACCAGGAGTAGAGAGCGGTGGG - Intergenic
1151675630 17:75595957-75595979 CACCAGCCTCAGGGAGGGCACGG - Intergenic
1151716783 17:75835144-75835166 CACCAGGCACAGAGCTGGGCAGG + Intronic
1151989364 17:77564400-77564422 CTCTAGGCTCAGAGAAGGGAGGG - Intergenic
1152160341 17:78664752-78664774 CACCTGGCTGGGAGAGGGGTGGG + Intergenic
1152214361 17:79024014-79024036 CGCCAGGCTGAGAGTGGGGGTGG - Intronic
1152299043 17:79484819-79484841 CAGCAGGCTCAGAGGAGGCTAGG - Intronic
1152730421 17:81967179-81967201 CAACCGGCTCAGAGTGGGGGAGG + Intergenic
1152758020 17:82095161-82095183 CAACGGGCTCAGGGAGGTGTGGG - Intronic
1152870513 17:82751142-82751164 CCCCAGGATCTGGGAGGGGTCGG - Exonic
1153618507 18:6954928-6954950 CAGAAGGTGCAGAGAGGGGTGGG + Intronic
1154122568 18:11663763-11663785 CACCAGGCACAGAGCAGAGTGGG + Intergenic
1156233044 18:35173525-35173547 CCCCATGCTCAGTGAGCGGTGGG - Intergenic
1156492179 18:37502752-37502774 CACCAGGCAGAGAGAGGGATGGG - Intronic
1157434743 18:47658851-47658873 CACCAGCCTCAGAGAGGACCTGG + Intergenic
1157619336 18:49007068-49007090 TGCCAGGCTGAGAGAGGAGTGGG - Intergenic
1157699044 18:49748201-49748223 CATCAGGCTCAGAGAGGCACTGG - Intergenic
1160279989 18:77480319-77480341 CACCAGGGTCTGTCAGGGGTGGG - Intergenic
1160292781 18:77609356-77609378 CTCCAATCTCAGAGTGGGGTGGG + Intergenic
1160369538 18:78360464-78360486 CACCAGGCACAGAGAGGCAAAGG + Intergenic
1160662669 19:308384-308406 CACCTGGCTGGGAGAGGGGAGGG - Intronic
1161221445 19:3119948-3119970 CCCCAGGCCCAGAGAGGGCTGGG - Intronic
1161479651 19:4504206-4504228 CCCCAGGCTCCGAGAGGGGCAGG + Exonic
1161770005 19:6225922-6225944 CACAAGGCTCAGGGAGAGATAGG + Intronic
1161972568 19:7590770-7590792 CGCCAAGCTCACAGAGGGGCAGG + Intergenic
1162231576 19:9270976-9270998 CTCCAGTCTCGGAGAGGGGTTGG + Intergenic
1162449658 19:10747238-10747260 CACCTGCCTCAGAGAGGAGGTGG - Intronic
1162571895 19:11479221-11479243 CACGAGGCCCAGAGAGGGAAAGG + Intronic
1163086071 19:14980174-14980196 AGCCAGGCTCAGAGAGGGAGAGG - Intronic
1163369116 19:16892261-16892283 CACCAGGCCCAGAGCCTGGTTGG + Exonic
1163648870 19:18505666-18505688 CACCAGGCACACACAGGGGAGGG + Intronic
1165048448 19:33125221-33125243 CCCCAGGATCAGTGTGGGGTGGG + Intronic
1165445620 19:35855552-35855574 CCCCAGGGTCTGAGAGGGGAGGG - Intronic
1165617445 19:37214505-37214527 GATCAAGCCCAGAGAGGGGTTGG + Intronic
1166666617 19:44684056-44684078 CAGCAGGTTCTGAGAGGGGCTGG - Exonic
1166683298 19:44781187-44781209 CACCTGGGTGGGAGAGGGGTGGG - Exonic
1167015739 19:46839814-46839836 CTCCAGGATCAGAGGGGGTTAGG - Intronic
1167650551 19:50726258-50726280 CCCGAGGCTCACAGAGGGGAAGG - Intergenic
1168728682 19:58607031-58607053 GCGCAGGCGCAGAGAGGGGTCGG - Intergenic
927676416 2:25109950-25109972 CACCAGCCTCCGAGTGGGCTTGG - Intronic
927824598 2:26299200-26299222 CAGCAGGCTGTGAGAGGGGAAGG + Intergenic
929942176 2:46342596-46342618 CACCAGTAACACAGAGGGGTTGG - Intronic
930884971 2:56314954-56314976 CACCAGGCTCTGGGAAGGGAAGG - Intronic
931300406 2:60973433-60973455 CACCAATCTCGGAGAAGGGTTGG + Intronic
931372684 2:61678330-61678352 GAACAGGTTCAGAGAGGGTTTGG - Intergenic
931695029 2:64865144-64865166 CACCGGGCACAGGGCGGGGTGGG - Intergenic
931849996 2:66243483-66243505 AACCAGGCTCTGAGAGGGACTGG - Intergenic
931850939 2:66249851-66249873 AACCAGGCTCTGAGAGGGACTGG - Intergenic
933840952 2:86285118-86285140 CCCAAGGCTGAGGGAGGGGTGGG - Intronic
936011845 2:108930090-108930112 CACCAGGCTCCAGGAGGGCTGGG + Intronic
936091047 2:109501688-109501710 CACCCAGCTCACAGAGGGGGAGG + Intronic
938108591 2:128549775-128549797 CACCAGCCCCAGGGTGGGGTGGG - Intergenic
941387412 2:164870446-164870468 CACCAAGATCAGAGAAGTGTGGG - Intergenic
942248527 2:174028341-174028363 CACCAGGTACAGAGAAGGGCAGG + Intergenic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
946016435 2:216607735-216607757 CACCAGGCACACAGTGGGGAGGG + Intergenic
946109849 2:217405206-217405228 CACCAGGCTAAGGGATGGGGAGG + Intronic
948686277 2:239671640-239671662 CACCCTGCTCGGAGAGGGCTCGG - Intergenic
948687150 2:239676562-239676584 CACCAGGGTCAGACAGGGCAGGG - Intergenic
948897553 2:240934364-240934386 CTCCGGGCTCAGAGAGGAGCTGG + Intronic
1169075421 20:2757121-2757143 CTCCAGGCTGAGACAGGGGAGGG + Intronic
1169195981 20:3682165-3682187 GGCCAGGCTCCGAGCGGGGTTGG - Exonic
1170827316 20:19808272-19808294 GACCAGGCTCAGGGAGGAGAGGG - Intergenic
1171195101 20:23190792-23190814 CTCCAGGCTCAAGGAGGGATTGG + Intergenic
1172321176 20:33995963-33995985 CATAAGGCACAGAAAGGGGTGGG - Intronic
1172448239 20:35004105-35004127 CAGGAGGCTCAGAGAAGGGAAGG + Intronic
1172505058 20:35455364-35455386 CCCGAGGCCCAGAGAGGGGCTGG + Exonic
1172847585 20:37938978-37939000 CAGAAGGCTCCCAGAGGGGTGGG + Intronic
1172870491 20:38132567-38132589 CAAGAGGCACAGAGAGGGGAAGG + Intronic
1173081272 20:39870285-39870307 CAGCAGGCACAGTGAGGGGGTGG + Intergenic
1173595616 20:44257123-44257145 CGCCAGGGTCAGAGCGGGGAAGG - Intronic
1174056239 20:47800344-47800366 GGCCAGGCTCAGAGAGGGCCAGG - Intergenic
1174254337 20:49243137-49243159 CAGGTGGCTCTGAGAGGGGTGGG - Intronic
1174449140 20:50609126-50609148 CACCAGGCTCAGAGAGGGGTGGG + Intronic
1175981488 20:62741011-62741033 GGCCAGGCTCAGCGAGGGGAGGG + Intronic
1176002531 20:62839461-62839483 CACCAGGCTAAGACAGGGGCGGG - Intronic
1176064383 20:63187194-63187216 CCCCTGGCTCACAGAGAGGTGGG + Intergenic
1176297702 21:5083010-5083032 CCCCAGCCTCAGGGAGGGGCTGG + Intergenic
1176305356 21:5120345-5120367 CACCAGGCTGAGGGGTGGGTGGG + Intronic
1178039565 21:28624719-28624741 AACCAGGCACAGAGAGGACTAGG + Intergenic
1178855954 21:36250544-36250566 CTGCAGGCTGAGAGAGCGGTAGG + Intronic
1179478879 21:41665419-41665441 CTGCAGGCTCAGACAGGGCTGGG + Intergenic
1179596136 21:42444300-42444322 CACCAGCCTCAGGGAGGCCTAGG - Intronic
1179851699 21:44141686-44141708 CACCAGGCTGAGGGGTGGGTGGG - Intronic
1179859327 21:44178939-44178961 CCCCAGCCTCAGGGAGGGGCTGG - Intergenic
1181181096 22:21069055-21069077 GTCCAGCCTCAGAGTGGGGTAGG + Intergenic
1181465975 22:23110847-23110869 CGCCAGCCTCAGAGTGTGGTGGG - Intronic
1181978857 22:26752170-26752192 ACCGATGCTCAGAGAGGGGTGGG + Intergenic
1181993299 22:26854744-26854766 CCTGAGGCTCAGAGAGGGTTAGG + Intergenic
1182355191 22:29719772-29719794 CACCAGGACCAGGGAGGGGGTGG - Intergenic
1182448268 22:30402497-30402519 AAACAGGCTCAGAGAGGGGAGGG + Intronic
1183161262 22:36114859-36114881 CACCAGGCCCAGAGCCAGGTGGG - Intergenic
1183255322 22:36758075-36758097 CACCAGCCTCACAGAAGGGAGGG + Intergenic
1183363092 22:37393130-37393152 CAGGAGGCTCAGAGAGGGTGAGG - Intronic
1183456711 22:37926914-37926936 CAACAGGCTTAGAGAGGAGAGGG - Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184648103 22:45907018-45907040 CTCCGGGCTGGGAGAGGGGTGGG + Intergenic
1184914636 22:47561229-47561251 CACCAGGCTCTGAGAGGCGCTGG + Intergenic
1184973229 22:48042842-48042864 AACCAGGCTCAGGTCGGGGTGGG + Intergenic
1185158624 22:49209120-49209142 CACCAGGCTGGCAGAGGGGGCGG + Intergenic
1185191311 22:49438247-49438269 CAGCAGCCTCAGAAAGGAGTTGG + Intronic
1185204135 22:49528288-49528310 CTCCAGCCTCTGAGAGGGGCAGG + Intronic
1185300132 22:50075214-50075236 CGCCAGACTCAGGGAGGGCTGGG + Intronic
950028817 3:9838447-9838469 CACCAAGCTGTGAGAGGGCTGGG - Intronic
950297765 3:11846754-11846776 CACAAGGCTGAGTGTGGGGTGGG + Exonic
950589907 3:13929675-13929697 CACGTGGCCCAGAGAGGGGCAGG + Intergenic
950884718 3:16353306-16353328 CCCCAGCCTTAGAGAGGGGCAGG + Intronic
950899309 3:16482920-16482942 CCCCAGGGTCAGAGTTGGGTGGG - Intronic
951092949 3:18597104-18597126 CAGCAGGCAAAGAGAGGGCTTGG + Intergenic
952154878 3:30631811-30631833 GAACAGGCACAGAGAGTGGTTGG + Intronic
952978501 3:38716425-38716447 CAGCAGGCAAAGAGAGAGGTTGG - Intronic
953097578 3:39793813-39793835 CACCTGGCTCAGGGATGGGATGG + Intergenic
953330165 3:42046067-42046089 CTGCAGGCTCAGAGATGTGTAGG - Intronic
953406195 3:42660953-42660975 CATCAGGCACAGAGAGTGGTGGG - Intronic
953696471 3:45163966-45163988 GAGCAGGCTCTGAGAGAGGTGGG + Intergenic
956177577 3:66487738-66487760 CACGAGGCTCGAAGAAGGGTGGG + Intronic
957769790 3:84675862-84675884 CACCAGGGTCAGATGGGGGGTGG + Intergenic
960624109 3:119663488-119663510 CAGCAGGCTCAGAGAGGCTAAGG + Intronic
960656453 3:120009675-120009697 CACCAGGGTCTGTGGGGGGTGGG + Intronic
961337035 3:126186742-126186764 CACCAGGCCCCGTGAAGGGTGGG + Intronic
961478184 3:127161635-127161657 CTCCAGGCAGAGAGAGGGGCAGG - Intergenic
962255497 3:133867494-133867516 CACCAGGGTCAGAGCTGAGTGGG + Intronic
963038197 3:141050572-141050594 TACCTGGCACAGAGAGGGATTGG + Intergenic
964311591 3:155399549-155399571 CCACAGACACAGAGAGGGGTGGG + Intronic
966586264 3:181629019-181629041 AAACAGGCTCAGAGAGGTGAAGG - Intergenic
966911729 3:184563584-184563606 CAGCAGGCTCAGAGATGAGGAGG - Intronic
967297784 3:187982200-187982222 CCCCAAGCTCAGCCAGGGGTGGG + Intergenic
969228558 4:5814594-5814616 CATGAGGCTCAGAGAGGTCTAGG + Intronic
969257702 4:6013790-6013812 CTCCAGCCTCGGAGAGGGCTTGG + Intergenic
969418255 4:7074924-7074946 CCCAAGGCTCAGGCAGGGGTGGG + Intergenic
969422645 4:7106338-7106360 CACCAGCCTCAGAGATGGCAGGG - Intergenic
969514781 4:7641000-7641022 TCCCAGGGTCAGAGAAGGGTTGG + Intronic
969672275 4:8596408-8596430 TGCAAGGCACAGAGAGGGGTGGG - Intronic
970193198 4:13533962-13533984 CTCCAGGCCCTCAGAGGGGTAGG + Intergenic
970805363 4:20024449-20024471 CACCAGCCTGAGAGAGGTGCAGG - Intergenic
971362661 4:25951854-25951876 CACAGGGCTCACAGAGGGGCTGG + Intergenic
971364269 4:25964988-25965010 CACCAGGCACAGAGGAAGGTGGG - Intergenic
973605949 4:52588003-52588025 CACCAGCTTCAGAGAGGGACAGG + Intergenic
976566212 4:86553368-86553390 CACAAAGCTGAGAGAGGGCTTGG + Intronic
980243058 4:130202075-130202097 CTCCAGTCTCAGAGTAGGGTTGG + Intergenic
981484960 4:145276290-145276312 CTCCAGTCTCAGAGTGGGGTGGG - Intergenic
984919517 4:184751252-184751274 AACCAGGAGCAGAGAGGGCTTGG - Intergenic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985520937 5:373691-373713 CCCCAGGCTCAGGGAGGGCGGGG + Intronic
985713814 5:1445090-1445112 CTCCAGGCTCAGAACCGGGTGGG - Intronic
985842471 5:2318790-2318812 CACCAGGGCCAGCCAGGGGTTGG - Intergenic
985854260 5:2412831-2412853 CATGAGGCTGAGAGAGGGCTGGG + Intergenic
990558203 5:56957069-56957091 CAACAGGCTCAGAAAAGGGAAGG + Intronic
992618715 5:78571442-78571464 CACGCAGCTCAGAGAGTGGTAGG + Intronic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997788407 5:136734820-136734842 CAAGAGGCTCAGAGAGAGATTGG + Intergenic
997960372 5:138316247-138316269 CTCCAATCTCAGAGTGGGGTTGG + Intronic
997975913 5:138441122-138441144 CACATGGCACAGAGAGGGGAGGG + Intronic
998414310 5:141934778-141934800 CACCAGGCTGTGAGAGCTGTTGG + Intronic
999275696 5:150328642-150328664 CATCAGGCTCAGAGAGGGAAAGG - Intronic
999310183 5:150546774-150546796 CACCAGCCTCAGAGAGTGGCAGG - Intronic
999400491 5:151260177-151260199 CACCAGGCCCAGAGAAGGCCAGG - Intronic
999829301 5:155303774-155303796 AACCAGGGTCAGTGAGAGGTGGG + Intergenic
1001950689 5:175814581-175814603 CAGCAGCCTTAGAGAGGGGCTGG + Intronic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1002054944 5:176593483-176593505 CAGCAGGCTGAGTGTGGGGTGGG + Intronic
1003137450 6:3444677-3444699 CACAGGGCTCAGAGAGAGGCCGG - Intronic
1005899660 6:30206426-30206448 CACAGGGCTCAAAGAGGGGCAGG + Intronic
1006173106 6:32106730-32106752 CTCCAGGCTGAGAGAAGGGCTGG - Intronic
1006375262 6:33668375-33668397 CCCAAGGCTTAGAGATGGGTGGG - Intronic
1006809491 6:36810731-36810753 AACCAGGCCCAGAGAGAGATGGG + Intronic
1006911358 6:37565767-37565789 CAGCAGCCTCAGGGAGGGCTGGG - Intergenic
1007531695 6:42548303-42548325 CTCCAGGCACAGAAAAGGGTAGG - Intergenic
1010398401 6:75419376-75419398 AACCAGGAACAGACAGGGGTTGG - Intronic
1012052362 6:94361665-94361687 CTCCAGTCTCAGAGCAGGGTTGG - Intergenic
1012382779 6:98640213-98640235 CACGAGGCTCAGGGAGGGCATGG - Intergenic
1013451517 6:110286323-110286345 CACCTGGGTTAGAGATGGGTGGG + Intronic
1013752178 6:113420164-113420186 CAGCAGTCTCAGGGATGGGTTGG - Intergenic
1017431702 6:154377897-154377919 CACCAGGCTCTGAGAGAGCAAGG - Intronic
1017947270 6:159105748-159105770 AAGCAGGCTAAGAGAGGGCTGGG - Intergenic
1018343939 6:162881942-162881964 CACCAAGACCAGAGATGGGTGGG + Intronic
1018423258 6:163658334-163658356 CACCACGCTCAAAGAGGCTTTGG - Intergenic
1018910976 6:168100923-168100945 CACCAGGGTGAGGGTGGGGTGGG + Intergenic
1019486819 7:1293230-1293252 GACGAGGCCCAGAGAGGGGCAGG + Intergenic
1019493143 7:1324378-1324400 CACCAGCCAGAGAGCGGGGTGGG - Intergenic
1019735019 7:2646342-2646364 AACCAGGCTCGGAGAGGTGGAGG + Intronic
1019738078 7:2660223-2660245 CGCCAGCCTCACAGTGGGGTTGG + Intronic
1022816177 7:33916627-33916649 CAGCAGGCTCTTAGAGGAGTTGG - Intronic
1023867805 7:44247090-44247112 CACCTGGCACAGAGTGGGGTGGG + Intronic
1024084621 7:45883113-45883135 CACCAAGAGCAGGGAGGGGTGGG - Intergenic
1025236759 7:57239811-57239833 GGCCAGGCTCAGAGAGGGCCAGG + Intergenic
1029197573 7:98816563-98816585 CACCAGGCACAGAGAGAGGTAGG + Intergenic
1029581910 7:101441941-101441963 AAACAGGCTCAGAGAGGTTTAGG + Intronic
1029728911 7:102426533-102426555 TACAGGGCTCAGAGAGGGGCCGG - Exonic
1030551524 7:110967396-110967418 CACCAGGATCAGGGTGGGGGTGG - Intronic
1032789361 7:135231296-135231318 CCCCAGGCTCAGAGAGGGCCAGG - Intergenic
1033245624 7:139714420-139714442 CAGCAGGCTGAGGGAGGGGCTGG + Intronic
1034695417 7:153048874-153048896 AACCAGGCTCAGAGAACTGTGGG - Intergenic
1034758073 7:153641757-153641779 CAGCAGCCTGAGAGAGGGCTTGG + Intergenic
1035050760 7:155997961-155997983 AACCAGGCTCAGGGAGGCTTGGG - Intergenic
1035741371 8:1930661-1930683 CCCCAGGCTCTGGGAGGGGCTGG - Intronic
1036461184 8:8954265-8954287 CAACAGGCACACAGAGGGGAAGG - Intergenic
1036519290 8:9475349-9475371 CAGCATGCACAGAGAAGGGTAGG + Intergenic
1036662213 8:10715753-10715775 AGCGAGGCTCAGGGAGGGGTGGG + Intergenic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1038197926 8:25385101-25385123 CAGCAGGCACAGAGAGAGCTGGG + Intronic
1042736339 8:71993459-71993481 CATGAGGCTGAGACAGGGGTTGG + Intronic
1044554333 8:93545810-93545832 TACCAAGCTCAGTCAGGGGTTGG + Intergenic
1046037086 8:108855764-108855786 AACCAGCCTCAGAGAAAGGTGGG + Intergenic
1047229655 8:122985614-122985636 AACCAGGCTGAGAGCTGGGTTGG + Intergenic
1048034310 8:130662625-130662647 CTCCTGGCTCAGAGAGAGGCTGG - Intergenic
1049069412 8:140345235-140345257 CACCAGGAACAGAGATGGGGTGG + Intronic
1049303439 8:141883942-141883964 CTCCAGGCTCACACAGGGCTGGG - Intergenic
1049431327 8:142566661-142566683 CACCAGGCTCCCAAAGGGCTGGG - Intergenic
1049434721 8:142581206-142581228 CCCCAGGCTGAGAGAGGAGAGGG - Intergenic
1049795652 8:144496237-144496259 CCCCAGGTTCAGAGAGGGGCGGG - Intronic
1049802995 8:144526881-144526903 CACCAGGGTCAGAGCCGGGATGG + Exonic
1052064294 9:23997657-23997679 CACCAGGGTCAGTTGGGGGTTGG + Intergenic
1052245769 9:26332170-26332192 CACCAGGATCAGACATGAGTGGG + Intergenic
1052820060 9:33131270-33131292 AAACAGGCTCAGAGAGGGACAGG - Intronic
1055032542 9:71785066-71785088 CACCAGGGCCAGTCAGGGGTGGG + Intronic
1057182232 9:93036411-93036433 GGCCAGGCTCAGAGATGGGGAGG + Intergenic
1057871621 9:98722463-98722485 AAACAGGTGCAGAGAGGGGTGGG - Intergenic
1058983931 9:110194895-110194917 AAACTGCCTCAGAGAGGGGTTGG - Intronic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059451141 9:114372159-114372181 CTTGAGGCTGAGAGAGGGGTTGG + Intronic
1059798546 9:117726668-117726690 CACCTGCCTCACAGAGTGGTTGG - Intergenic
1059880822 9:118687061-118687083 GACCAGGCTCATTCAGGGGTGGG - Intergenic
1060183238 9:121548017-121548039 CGACAGGGGCAGAGAGGGGTGGG - Intergenic
1060794338 9:126504136-126504158 CGCCTGGCTCTGAGAGGGGCTGG - Exonic
1060816097 9:126636055-126636077 CAAAAGGCTCATAGAGGGGAGGG - Intronic
1061052699 9:128205574-128205596 CACCAGGCACAGGGACGTGTGGG + Intronic
1061062083 9:128255496-128255518 CACCAGGCTCAGGCAGGCGAGGG + Intergenic
1061562811 9:131417334-131417356 CACCAGGGTCAGAGGGGGAAGGG - Intronic
1061704282 9:132440767-132440789 GCCGAGGCTCAGAGAGGTGTAGG + Intronic
1062080105 9:134619243-134619265 CACCAGGGTCAGAGAGGACGAGG + Intergenic
1062229381 9:135472951-135472973 CACCAGGCTGAGAGAAAAGTGGG + Intergenic
1062349413 9:136131780-136131802 TCCCAGGCACAGAGTGGGGTGGG + Intergenic
1062437270 9:136551867-136551889 CACCAGGCACAGGTCGGGGTGGG - Intergenic
1203786051 EBV:128137-128159 CACCAGCCTTAGAGAGTTGTGGG - Intergenic
1185601921 X:1346024-1346046 CACCACGCCCAGCGTGGGGTTGG - Intronic
1187274750 X:17807415-17807437 CACCAGGCTCAGGAAGGCTTAGG - Intronic
1187435801 X:19267923-19267945 CAGAAGGCTCAGGGAGAGGTAGG + Intergenic
1189163788 X:38838711-38838733 CACTACCCTCAGAGAGGGGAAGG + Intergenic
1190330240 X:49231105-49231127 CATCCGGGTCAGAGAGGGGGCGG + Intronic
1190342575 X:49309090-49309112 CAGCAGGCTGTGAGAGGGGAAGG + Intronic
1190444910 X:50514801-50514823 CTCCAATCTCAGAGCGGGGTTGG - Intergenic
1191669641 X:63737325-63737347 CAGCTGGCTCAGAGAGGCGCTGG - Intronic
1192051622 X:67729596-67729618 CCCCAGGCTAAGAGACAGGTGGG - Exonic
1192313765 X:70036453-70036475 CACCTGTCTCAGACAGAGGTAGG - Exonic
1192963857 X:76156909-76156931 CACCAGGCTTAGACAGAGGAAGG + Intergenic
1193589648 X:83372866-83372888 TAACAGGGGCAGAGAGGGGTAGG + Intergenic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1199091513 X:143698575-143698597 CACGAGGCTAAGAGAAGGCTGGG - Intergenic
1200010097 X:153114315-153114337 CACCAGGCACACAGAGAGGTAGG - Intergenic
1200029503 X:153285607-153285629 CACCAGGCACACAGAGAGGTAGG + Intergenic
1200211917 X:154350497-154350519 TAACAGGCTCAGAGACGGGCAGG + Intronic
1200226152 X:154419036-154419058 CATGAGGCTCCGAGAGCGGTCGG + Intronic