ID: 1174449587

View in Genome Browser
Species Human (GRCh38)
Location 20:50611010-50611032
Sequence CCTTCCTCAGGGATGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174449587_1174449595 16 Left 1174449587 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1174449595 20:50611049-50611071 AGCCTTCCCATTCCTAAAATGGG 0: 1
1: 0
2: 3
3: 42
4: 347
1174449587_1174449602 29 Left 1174449587 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1174449602 20:50611062-50611084 CTAAAATGGGGAGGAGACCCAGG 0: 1
1: 0
2: 1
3: 23
4: 195
1174449587_1174449598 20 Left 1174449587 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1174449598 20:50611053-50611075 TTCCCATTCCTAAAATGGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 212
1174449587_1174449594 15 Left 1174449587 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1174449594 20:50611048-50611070 CAGCCTTCCCATTCCTAAAATGG 0: 1
1: 0
2: 4
3: 55
4: 397
1174449587_1174449596 17 Left 1174449587 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1174449596 20:50611050-50611072 GCCTTCCCATTCCTAAAATGGGG 0: 1
1: 0
2: 2
3: 39
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174449587 Original CRISPR CCTTCCTCAGGGATGGTGAG GGG (reversed) Intronic
900755090 1:4429091-4429113 CCTTCCTCTGGGAAGGAAAGAGG + Intergenic
900879661 1:5371708-5371730 CCTTCCTCAGTGCTGCTGTGAGG - Intergenic
901061871 1:6475373-6475395 CCTTCCTCCGGGATGGGGGTGGG - Intronic
901781982 1:11600097-11600119 CCTCTCTCAGCCATGGTGAGGGG + Intergenic
902149201 1:14429221-14429243 CATTCCTCAGAGATGCTGATGGG - Intergenic
902244882 1:15114301-15114323 CCCTGCTCAGGGAGGTTGAGGGG - Intronic
902806303 1:18863376-18863398 CCTGCCCCAGGGGTGGTCAGGGG - Intronic
904277620 1:29394730-29394752 CCATGCTCAGGGATGGGGGGTGG - Intergenic
906684680 1:47755820-47755842 CTTTCCTCAGTGATGGTGGGTGG - Intergenic
906730120 1:48073835-48073857 CCTCCCTCAGGTCTGCTGAGAGG - Intergenic
909003687 1:70250027-70250049 ACCTCCTAGGGGATGGTGAGCGG - Exonic
910829873 1:91449720-91449742 CCTTCATCTGAGATGGTCAGTGG - Intergenic
911584151 1:99671067-99671089 CCCTGCTTAGGGATTGTGAGTGG - Intronic
915524491 1:156467606-156467628 TCTTCATCAGGGAGGCTGAGAGG + Exonic
917059222 1:171018162-171018184 CCTTCCTCTGGGATCTCGAGGGG - Intronic
917967316 1:180186863-180186885 CCTTCCTCTCTGAAGGTGAGAGG + Intronic
918204647 1:182298095-182298117 GCTTCCTCTGGGATGGAGTGTGG - Intergenic
919515039 1:198511762-198511784 CCCTCCGGAGGGATGGTGAGGGG + Intergenic
920062368 1:203236270-203236292 CCATCCTCTGGGAAGGGGAGTGG + Intronic
920435449 1:205943949-205943971 CCTTCCTCAGGGGTGTTCAGAGG - Intergenic
920542752 1:206791837-206791859 TCTTTTTCTGGGATGGTGAGAGG - Intergenic
921147831 1:212376529-212376551 CCTTCCTCAGAGCTGCTGTGGGG + Intronic
1063010862 10:2020380-2020402 ACTTCCTGATGGACGGTGAGGGG - Intergenic
1063275834 10:4567030-4567052 CTTTCCTTAGAGAGGGTGAGTGG - Intergenic
1064153918 10:12888013-12888035 CCTTCCTCAGAGATGTAGAACGG + Intergenic
1068735767 10:60411597-60411619 ACTTCTACAGGGTTGGTGAGAGG - Intronic
1069175429 10:65283942-65283964 CATTCCTCTGGTATGGGGAGAGG + Intergenic
1069881428 10:71596089-71596111 CCCTGCTCAGGGGTGGTGGGAGG + Intronic
1070628517 10:78068021-78068043 CCTTGCTCTGTGATGGGGAGGGG - Intergenic
1071778915 10:88820468-88820490 CCTTTCCCAGGGACGGTGTGAGG + Exonic
1072270120 10:93768276-93768298 ACTTCCCCAGGACTGGTGAGTGG - Intronic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1073001608 10:100290007-100290029 CCCTCCCCAGGCGTGGTGAGTGG - Exonic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073383368 10:103099719-103099741 CTTTCCTCAGTGATGGTGTTTGG - Intronic
1074060388 10:109960189-109960211 CCTACCTCAGGGTTGTTGTGAGG - Intergenic
1074383070 10:112995823-112995845 CCCTCATCAGGGATGGGGAAGGG - Intronic
1074438110 10:113451881-113451903 CCATCCCCAGAGATGGTGAATGG + Intergenic
1074559145 10:114519653-114519675 TCTTGCTCAGGGATGGTTAAAGG + Intronic
1075653315 10:124144627-124144649 CCTCACTCAGGGCTGCTGAGGGG - Intergenic
1076831098 10:132994689-132994711 GCTGCCTCAGGGAAGCTGAGTGG + Intergenic
1077267325 11:1657807-1657829 GTTTCTTCAGGGCTGGTGAGGGG - Intergenic
1077817523 11:5700481-5700503 TGTTCAACAGGGATGGTGAGAGG + Intronic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1081618234 11:44603184-44603206 CCTTCCTCAGGGTGAGTGCGGGG - Intronic
1083185272 11:61013993-61014015 CCTTCTTTGGGGATGGTGATGGG - Exonic
1083361572 11:62112442-62112464 CCCTCCTCAGGCCGGGTGAGCGG + Intergenic
1083427516 11:62596199-62596221 CCTTCCTCAGTGATTGGGGGTGG - Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1085127764 11:74013437-74013459 TCTTCCTCAGGCAGGTTGAGGGG + Exonic
1085354445 11:75822905-75822927 CCTTCCTGGAGGATGGGGAGTGG + Intronic
1085958145 11:81426594-81426616 CCTTCCTCAGAGATTTTGGGAGG - Intergenic
1087157478 11:94919425-94919447 CCATCCTCTGGGGAGGTGAGAGG - Intergenic
1088933940 11:114379729-114379751 ACTTTCTGAGGGATGTTGAGAGG - Intergenic
1089587851 11:119521348-119521370 CCTTCCTCTGGCCTGGGGAGGGG - Intergenic
1089705142 11:120272370-120272392 CTCTCCCCAGGGATGGTGTGTGG - Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1089821385 11:121230329-121230351 CTTTCCTCTGGCATGTTGAGGGG + Intergenic
1090438589 11:126708033-126708055 CCTGCTTCAGGGATGCGGAGGGG - Intronic
1090909347 11:131104961-131104983 CCTTCCTCAGAGATGAGGGGAGG + Intergenic
1091692375 12:2605826-2605848 CCTTCCCCAGGAATGCTGATGGG - Intronic
1092065545 12:5587480-5587502 TTTTCCTCAGGGCTGATGAGAGG - Intronic
1092489311 12:8930705-8930727 CCTTCCTCAGGAATGGGTGGTGG + Exonic
1092782090 12:11996648-11996670 CCAACCTCAGGGAGGGGGAGTGG - Intergenic
1095420693 12:42020948-42020970 CCTTTCTCAAGGATGTTGAAAGG - Intergenic
1095499958 12:42827224-42827246 CCTTCCACAGTGATGATGAAAGG + Intergenic
1096536430 12:52278072-52278094 CCTTCCCCAGGCCTGGGGAGAGG - Intronic
1096946482 12:55413832-55413854 CCTTCCTCAGGAATGGGTGGTGG - Intergenic
1098088850 12:66879372-66879394 CCTTCCACAGGGTTGTTGTGTGG - Intergenic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1098360648 12:69651266-69651288 CCTTCATGAGGCATCGTGAGAGG - Intronic
1100208812 12:92380101-92380123 ACTGTCACAGGGATGGTGAGAGG - Intergenic
1101306894 12:103537252-103537274 CCTTCAGAAGGGTTGGTGAGTGG + Intergenic
1103146232 12:118597734-118597756 CCTTCCAAAGTGCTGGTGAGAGG - Intergenic
1103817384 12:123669654-123669676 CCTTCCTTGGGGATTGTGTGAGG - Intergenic
1104277161 12:127340275-127340297 CCTTCCACACTGAGGGTGAGGGG - Intergenic
1104422978 12:128652321-128652343 CCTTCCTCCGGGATGGGAAGTGG + Intronic
1104432511 12:128728028-128728050 CCTGCCCCAGGAATGGTCAGAGG - Intergenic
1109802055 13:67393188-67393210 GCTTCCACAGGGCTGGTGTGTGG + Intergenic
1109846936 13:68005499-68005521 AGGGCCTCAGGGATGGTGAGAGG + Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1110817321 13:79876396-79876418 GCTTCCTCAGGGAGGCTCAGAGG - Intergenic
1113442627 13:110341038-110341060 GCTTCCCCAGGGGTGGGGAGGGG + Intronic
1113469803 13:110536264-110536286 CCTACCTCCAGGATGGGGAGAGG + Intronic
1113623315 13:111778595-111778617 CCCCCCTAAGGGAAGGTGAGGGG - Intergenic
1114287895 14:21262593-21262615 CCTTCCTGGGTGATGGTAAGAGG - Intronic
1115368344 14:32583915-32583937 CCTCCCTCGGGAATCGTGAGGGG - Intronic
1118074126 14:62280081-62280103 ACTTCCTCAGGGAGAGTAAGAGG + Intergenic
1119764747 14:77181443-77181465 CATGCCTCAGGGAGGGCGAGGGG + Intronic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1121942058 14:98080408-98080430 CTGTGGTCAGGGATGGTGAGTGG + Intergenic
1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG + Intergenic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1123028460 14:105439548-105439570 CTGTCCTCAGGGGTGGTGGGTGG + Intronic
1123491764 15:20786654-20786676 CCTTCCTCAGTGGTGGTGGTGGG + Intergenic
1123548267 15:21355748-21355770 CCTTCCTCAGTGGTGGTGGTGGG + Intergenic
1124341393 15:28891530-28891552 CCCTTCACAGGGATGGGGAGAGG + Intronic
1128611420 15:69076643-69076665 ACTGCCTCAGGGATGGTTGGAGG - Intergenic
1128790036 15:70426367-70426389 CCTTCCTCAGGCCTGGCAAGTGG + Intergenic
1129414482 15:75367845-75367867 CCTTCCTAAGGGATGTCCAGAGG + Intronic
1129693259 15:77725604-77725626 CCTTTCTCAGGGAAGTTGTGAGG - Intronic
1130081720 15:80739637-80739659 CCTTTCTCATGGATGGTGAAGGG - Intronic
1132144170 15:99417065-99417087 CCCACCCCAGAGATGGTGAGAGG - Intergenic
1202956599 15_KI270727v1_random:82978-83000 CCTTCCTCAGTGGTGGTGGTGGG + Intergenic
1135096430 16:19568471-19568493 CCATCCTTCGGGAAGGTGAGAGG - Intronic
1136662107 16:31772049-31772071 CCCTCCTCACTGAGGGTGAGGGG + Intronic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1138496528 16:57412309-57412331 CCTTGCTGAGGGGTGGGGAGAGG + Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG + Intergenic
1141002071 16:80317621-80317643 CCTTCCTAAGTGAGGGTCAGCGG - Intergenic
1141714262 16:85717693-85717715 TCTCCCTGAGGGATGGTGTGAGG - Intronic
1142159268 16:88548248-88548270 CCTTCCCCCGGGAGGGTGACAGG - Intergenic
1142607172 17:1088282-1088304 CCCTCCTGAGGGATGAGGAGAGG + Intronic
1142811232 17:2396569-2396591 CTTTCAGCAGGGATGCTGAGCGG - Intronic
1143283798 17:5774427-5774449 GCTTCCTAAGGGCTGCTGAGTGG - Intronic
1143625599 17:8108857-8108879 CCTTCCTCCTGGGTGGGGAGGGG - Intronic
1146653741 17:34623159-34623181 CCTCCCCCAGGGGGGGTGAGGGG + Intronic
1146672500 17:34751270-34751292 CCTCCCTCAGAGATGTTGTGAGG - Intergenic
1147185857 17:38712803-38712825 CCTTCAGGAGGGATGGTGTGTGG + Intronic
1147671381 17:42178785-42178807 TCTACCGCAAGGATGGTGAGGGG - Exonic
1148860174 17:50600518-50600540 GGGTCCTCAGGGATGGGGAGGGG + Intronic
1149113342 17:53061791-53061813 CCTTCCTCGGTGTTTGTGAGGGG + Intergenic
1150400271 17:64850807-64850829 CCATCCTCTGGGGTGGGGAGTGG + Intergenic
1150648596 17:66995360-66995382 CCTTCCTCAGGCTTCATGAGAGG - Intronic
1151193542 17:72415769-72415791 CCTCCCTCTGGGAGGGTGAGAGG + Intergenic
1151329782 17:73399943-73399965 CCTCCCTCAGGGTTGTTGTGAGG + Intronic
1151541973 17:74769281-74769303 CCTGGCTCAGGGATGGGCAGGGG - Exonic
1151898147 17:76994226-76994248 CCTTGCTCAGAGATGATGGGAGG + Intergenic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152137443 17:78512987-78513009 CCTTCCTCTGGGCTGATAAGGGG - Intronic
1152239096 17:79152296-79152318 CCATCCTCAGTGAAGCTGAGAGG + Intronic
1152760293 17:82103950-82103972 CCCTCCTCAGTGATGGTGGCAGG + Intronic
1156489154 18:37486046-37486068 GCTCCCTCAGGGATGGTGGAGGG + Intronic
1156627369 18:38925178-38925200 TCTACCTCAGGGAGAGTGAGAGG + Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157159517 18:45300708-45300730 CCTACCTCAGAGATGCTCAGAGG - Intronic
1157392523 18:47314703-47314725 CTTTCCTCAGGGGTGGAGTGGGG - Intergenic
1158415056 18:57242878-57242900 CCTGGCTGTGGGATGGTGAGTGG + Intergenic
1158950085 18:62486374-62486396 CCCCCCTCAGGTATGGTGGGTGG - Intergenic
1160228904 18:77031839-77031861 CCTCTCTCATGGATGGGGAGAGG + Intronic
1160303961 18:77714183-77714205 GCTTCCTCAGGGCTGGGGATGGG + Intergenic
1160889362 19:1369122-1369144 CCTTTGTCAGGGAGGGTCAGAGG + Intronic
1166350886 19:42197561-42197583 CCTTCCTCAGGGGTGGGGAGTGG - Intergenic
1166377086 19:42333754-42333776 GCTTCCTCAGGCAAGGTTAGTGG + Exonic
1166741326 19:45116518-45116540 CCCTCCTCAGGCCTGCTGAGAGG - Intronic
1167285551 19:48596905-48596927 CCTTCCTCCGGAAAGGTGCGGGG + Exonic
1167853764 19:52221413-52221435 CATTTCTCAGGGAAGGAGAGGGG - Intronic
927015878 2:18961297-18961319 CTTTCCCCAGGAATGGAGAGAGG - Intergenic
927156263 2:20223532-20223554 CCATCCCCAGGGATGCAGAGGGG - Intronic
928202930 2:29262669-29262691 CCTTCCGCAGGGAGGGAGATGGG - Intronic
929596608 2:43180086-43180108 CCTGGCTCAGGGATGCAGAGTGG - Intergenic
931282666 2:60807851-60807873 CCTTGGTCAGGGATGGTGTTGGG + Intergenic
931994192 2:67824093-67824115 CTTTTCTCAGGGAAGATGAGAGG + Intergenic
934704094 2:96464253-96464275 CCTTCCTGAGCTAGGGTGAGAGG - Intergenic
934712046 2:96522734-96522756 CTTTGCTCAGGGCTGCTGAGAGG - Intergenic
935346345 2:102111893-102111915 CTTTCCTCAGGGCTTCTGAGTGG + Intronic
935512737 2:103995853-103995875 CCTGCCTCAGGCATGGTGGTGGG - Intergenic
936561914 2:113546676-113546698 CCATCATCAGTGATGGTGAGAGG + Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946588988 2:221222029-221222051 CCTCCCTCAGGGAAGGTGACAGG + Intergenic
948771276 2:240252435-240252457 CCTTGTTCAGAGATGGTGAAGGG - Intergenic
948885032 2:240878136-240878158 CCCTCCACGGGGAAGGTGAGAGG + Exonic
1168880829 20:1204738-1204760 CCTTCCTCTGGGGTGATGACAGG - Intronic
1169187574 20:3631647-3631669 TATGCCTCAGGGAAGGTGAGAGG - Intronic
1170305089 20:14929615-14929637 CCCTCCTCCAGGATGGGGAGAGG - Intronic
1171345637 20:24464202-24464224 CCTTCCAAAGGGTTGGAGAGTGG + Intergenic
1172588712 20:36102800-36102822 CCTTGCTCAATTATGGTGAGTGG - Intronic
1172967179 20:38845167-38845189 GCTTCCTCAGGCACGGAGAGGGG + Intronic
1174282606 20:49450097-49450119 CCATCCTCAGAGGTGGGGAGAGG + Intronic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174585512 20:51605045-51605067 GCTTTCGCAGGGAGGGTGAGGGG - Intronic
1175263971 20:57691576-57691598 GCTTCCTCAGGGATGGGGTAGGG + Intronic
1176294704 21:5065272-5065294 TCGGCCTCAGGGATGGAGAGTGG + Intergenic
1176359551 21:5983261-5983283 CCATCTGCAGGGATGGTGTGGGG + Intergenic
1179751020 21:43467647-43467669 CCTTCCGCAAGGATGGGGATGGG + Intergenic
1179763967 21:43555289-43555311 CCATCTGCAGGGATGGTGTGGGG - Intronic
1179862346 21:44196854-44196876 TCGGCCTCAGGGATGGAGAGTGG - Intergenic
1180859039 22:19066617-19066639 CCTATCTCAGGCAAGGTGAGAGG + Intronic
1181306609 22:21920635-21920657 CCTGGCTCAGGGGTGGGGAGCGG + Exonic
1181496397 22:23289600-23289622 CCTTCCTTATTGATGGTCAGCGG - Exonic
1181742307 22:24931097-24931119 CCATCCTCAGTGATGCTGAGGGG - Intergenic
1183009343 22:34932055-34932077 ACTTCCTCAGGGATTGGCAGGGG + Intergenic
1183346100 22:37309239-37309261 TCGTCCTCAGGGATGGAGAATGG - Exonic
1183565937 22:38615504-38615526 CTTTCCTCAGGGATCCAGAGGGG - Intronic
1183950064 22:41347812-41347834 CCTGCCTCAGGCATTGGGAGTGG + Intronic
1184508748 22:44919566-44919588 CCCAGCTCAAGGATGGTGAGAGG - Intronic
951528630 3:23678272-23678294 CCTTCCTGGGGGATGGGGCGTGG + Intergenic
952919202 3:38273445-38273467 CCTTCCTCAGGGCATGTGTGAGG + Intronic
953032861 3:39189397-39189419 CCATCCTCATGGTTGGTGTGGGG + Exonic
953759432 3:45674966-45674988 CCTTCACAAGGGTTGGTGAGGGG - Intronic
954450069 3:50567028-50567050 CCTTCCTCAGGGACCATCAGAGG - Intronic
954614095 3:51960715-51960737 CTTGCCTCAGGCCTGGTGAGTGG - Intronic
954630434 3:52045026-52045048 CTTCCCTCAGGGGAGGTGAGTGG + Intergenic
955383654 3:58461326-58461348 CTATCCTCTGGGAAGGTGAGTGG + Intergenic
955932518 3:64071829-64071851 TCTTCCTCTGGGATAGTAAGAGG - Intergenic
956262640 3:67361869-67361891 TGCTCCTCTGGGATGGTGAGGGG + Intronic
961003542 3:123389936-123389958 CCTTCCTCAAGAGTGGAGAGAGG + Intronic
961109097 3:124268612-124268634 CCTGCCTCGGAAATGGTGAGTGG - Intronic
962462937 3:135631341-135631363 CCTTGATCAGAGATGGTGATGGG - Intergenic
962967939 3:140371469-140371491 CCTTCCTCAGGGCTGGCTGGTGG + Intronic
963008779 3:140750340-140750362 CATGGCTCAGGGATGGTGAGTGG + Intergenic
964184325 3:153924448-153924470 CCTTCCAAAGTGCTGGTGAGAGG - Intergenic
965476246 3:169159012-169159034 CCTTTCACAGGGAAGGTGATGGG + Intronic
967046918 3:185745899-185745921 CCTTCCTCTGGTTTGGTGGGTGG + Intronic
967946030 3:194804963-194804985 CTTGCCCCAGGGATGCTGAGTGG - Intergenic
968984804 4:3869349-3869371 CTGGCCTCCGGGATGGTGAGAGG - Intergenic
971111867 4:23593867-23593889 ACTTACTCAGTGATGGTGGGAGG - Intergenic
971503114 4:27337862-27337884 CCTTCCTCTGTGATGCTCAGAGG + Intergenic
972209136 4:36815621-36815643 CCTTCCTTAGGGTCTGTGAGGGG - Intergenic
972744685 4:41921768-41921790 CCCTCCTCAGGGTCTGTGAGTGG + Intergenic
973735035 4:53863506-53863528 TATTCCTAAGGGATGGTGGGTGG - Intronic
974490487 4:62557887-62557909 TCTTCACCAGGGATGGTGGGAGG - Intergenic
977962437 4:103101171-103101193 CCTACCTCAGGGATGTGGTGAGG + Intergenic
978848757 4:113307765-113307787 GATTCCTCAGTGATAGTGAGTGG - Intronic
980120239 4:128720538-128720560 CCTCCTTCAGGGAGGGGGAGGGG + Intergenic
982705146 4:158700865-158700887 CCTTCCTTAGGAAGAGTGAGAGG + Intronic
984766500 4:183404343-183404365 CCTTCCTGAGGCGTGCTGAGTGG - Intergenic
985548361 5:521026-521048 TCTGCCTCAGGCAGGGTGAGGGG - Intronic
988567621 5:32332038-32332060 CTTTCCTCTGGGATGGGGAAAGG - Intergenic
988594810 5:32581748-32581770 CCTTCCCCAGGGCTGGTGTGGGG + Intronic
991958815 5:72021512-72021534 CCTTCCTCAGAGTAGGTGCGGGG - Intergenic
992178636 5:74175227-74175249 TCTTTCTCAGGAATGGTGAATGG - Intergenic
995575748 5:113531303-113531325 CCTTCCTCAGTGTCTGTGAGTGG - Intronic
995772310 5:115684884-115684906 AATTGCTCAGGGATGGTGGGAGG - Intergenic
998093440 5:139383897-139383919 CCTGCCTCAGGGACCCTGAGGGG - Intronic
1001093727 5:168760553-168760575 CCTACCCCAGGGCTGGTGGGTGG - Intronic
1003602093 6:7526941-7526963 TCCTCCTCAGGGAAGGGGAGTGG - Intergenic
1007418208 6:41704401-41704423 CCTTCCTCAGAGTCAGTGAGGGG + Intronic
1009908548 6:69897966-69897988 CAGACCTCAGGCATGGTGAGAGG - Intronic
1015707504 6:136104048-136104070 CTGTCCTCAGGGAGGGTGAGGGG + Intronic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1017875000 6:158516998-158517020 CCCTTCTCAGGGAAGGTGACGGG + Intergenic
1018450264 6:163901155-163901177 CATTCCACAGGCCTGGTGAGGGG - Intergenic
1018619674 6:165717808-165717830 CCATCCTCATGGGTGGGGAGTGG + Intronic
1018889477 6:167973222-167973244 CCTGCCTCAGTGATGGTGACGGG + Intergenic
1021420102 7:20437332-20437354 CCATCCTCTGGGAAGGAGAGCGG + Intergenic
1022434851 7:30373065-30373087 CCTACATCAGGGTTGGTGTGAGG + Intronic
1028291354 7:89068975-89068997 CCTTGCTCAAGAATGGTGACTGG + Intronic
1029374052 7:100167363-100167385 CCTCCTTCAGGGAAGGGGAGTGG + Intronic
1029868408 7:103661440-103661462 TCTTCCTCAAAGATGGAGAGAGG - Exonic
1031971182 7:128066191-128066213 CCTACCTCAGGGATGAGGGGTGG - Intronic
1032636884 7:133718830-133718852 CCATGCTCAGGGATAGTGGGTGG + Intronic
1033982383 7:147181302-147181324 CCTTCCTCAAGAAAGGTGTGAGG - Intronic
1034201177 7:149283883-149283905 CCTTCCTGAGGGATTCTGACAGG - Exonic
1034349448 7:150406634-150406656 CCTTTCTCAGGGCTGTTGTGAGG + Intronic
1035319920 7:158022156-158022178 GCTTCCACAGACATGGTGAGAGG + Intronic
1036125597 8:6059025-6059047 CCCTCTTCAGGCATGATGAGAGG - Intergenic
1037039676 8:14215963-14215985 CCCTCCTCAGGGTCTGTGAGGGG - Intronic
1037805157 8:22054807-22054829 TCTTCCTCAGAGATGGAGGGAGG - Intronic
1038406807 8:27328147-27328169 TCTTCTTGAGGGATGGTGGGTGG + Intronic
1041195504 8:55397878-55397900 CCACCCTCAGGGATGATGAGTGG - Intronic
1041777246 8:61536902-61536924 CCTTCAGCAAGGATGATGAGAGG - Intronic
1043526988 8:81107864-81107886 CCTGCCTCATGCATTGTGAGAGG - Intronic
1046570377 8:115956871-115956893 CCTGCCCCATGGAAGGTGAGAGG - Intergenic
1046725579 8:117670114-117670136 CCTTACTCAGGGATGTAGAATGG - Intergenic
1048280019 8:133098742-133098764 CATCCATCAGGGAGGGTGAGGGG + Intronic
1049296880 8:141845488-141845510 GCTTCCTCAGGGGTGGGGTGGGG - Intergenic
1049422023 8:142521234-142521256 GCTGCCTCAGGGCTGGGGAGTGG + Intronic
1049580615 8:143408939-143408961 CCTTGGGCAGGGATGCTGAGGGG + Intergenic
1049776503 8:144408305-144408327 CCAGGCCCAGGGATGGTGAGAGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1050419718 9:5450684-5450706 CCTTTCTTTGGGATGGAGAGAGG + Intronic
1051045114 9:12863735-12863757 TCTTCCTCTGGGATGGTGTTAGG + Intergenic
1052222136 9:26037591-26037613 CCTTAGACAGTGATGGTGAGTGG + Intergenic
1055570343 9:77610123-77610145 AGTTCCTCTGGGAAGGTGAGGGG - Intronic
1058164895 9:101608122-101608144 TCTTTCTCAGGGATGGTGGTCGG - Intronic
1058633728 9:107016508-107016530 GCTGCCTGAGGGATGGGGAGTGG + Intergenic
1058947194 9:109868853-109868875 CCTCCCTCAGGAATGTTGTGGGG - Intronic
1059752905 9:117265428-117265450 CCTTCCCCAGGCATGGGCAGAGG + Intronic
1060216866 9:121743700-121743722 CTATGCTGAGGGATGGTGAGTGG + Intronic
1061152848 9:128838581-128838603 CCTGCCTCTGGGTTGTTGAGAGG - Intronic
1061230624 9:129313743-129313765 CAGTCCTCAGGGGAGGTGAGGGG - Intergenic
1061669741 9:132182178-132182200 CCTTCCCCAGAGCTGGTGCGTGG - Intronic
1061802352 9:133119540-133119562 AGTTCCTCAGGGACGGAGAGAGG + Intronic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1186311808 X:8328192-8328214 GCTTCCACAGGGATGGTGCAGGG - Intergenic
1190459748 X:50660619-50660641 CCTAACTCAGAGATGGAGAGGGG - Intronic
1190731765 X:53231279-53231301 CCTTCATCAGGGATGTTGGGGGG + Intergenic
1191867624 X:65717866-65717888 ACTTCCCCAGGGTTGGAGAGAGG + Intronic
1191895639 X:65989631-65989653 TCATTCTCAGGGATGGTGTGAGG - Intergenic
1196741368 X:119028758-119028780 CCTCCCTCAGCACTGGTGAGAGG - Intergenic
1199794642 X:151182503-151182525 CATTCCTCCCGGATGGGGAGGGG + Intergenic