ID: 1174450413

View in Genome Browser
Species Human (GRCh38)
Location 20:50616702-50616724
Sequence CTCTTCTCTGCTGTGTGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 1, 2: 3, 3: 75, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174450413_1174450418 7 Left 1174450413 20:50616702-50616724 CCCGGTCACACAGCAGAGAAGAG 0: 1
1: 1
2: 3
3: 75
4: 489
Right 1174450418 20:50616732-50616754 CCACGTCTGAAACCACACAGTGG 0: 1
1: 0
2: 1
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174450413 Original CRISPR CTCTTCTCTGCTGTGTGACC GGG (reversed) Intronic
900131765 1:1090237-1090259 CTCATCTGTGCTGCGGGACCTGG - Intronic
900535383 1:3174489-3174511 TGCTTGCCTGCTGTGTGACCTGG + Intronic
901884809 1:12215365-12215387 CTCTGCCCTGCTTTGTGCCCTGG + Intergenic
902742349 1:18447508-18447530 CTCTGCCCTGCTGTCTGACACGG + Intergenic
902823463 1:18956936-18956958 CGATTCTCTGCTGGGGGACCCGG + Intergenic
903306583 1:22417252-22417274 CTCTTGATGGCTGTGTGACCTGG + Intergenic
903831323 1:26177152-26177174 CTCTTGTTAGCTGTGTGACCTGG - Intergenic
903956417 1:27029197-27029219 CTCTTATTGGCTGGGTGACCTGG + Intergenic
904261916 1:29292404-29292426 CCTTTCTTAGCTGTGTGACCTGG + Intronic
904306141 1:29591703-29591725 ATTTTCTCTGCTGTGTGATGTGG + Intergenic
904348830 1:29891819-29891841 TTGTTCTCTGCTGTGTTCCCTGG + Intergenic
905016427 1:34781715-34781737 CTCGCCTCTGCTGTGGGCCCCGG + Exonic
905114788 1:35629025-35629047 GTCTGACCTGCTGTGTGACCTGG + Intronic
905198366 1:36299128-36299150 CTCTTATTAGCTGTGTCACCTGG - Intronic
905233602 1:36530459-36530481 CTCTGCCCTGCTGTGTACCCCGG + Intergenic
905451189 1:38057700-38057722 CTCTTACCAGCTGTGTGACCAGG + Intergenic
905602575 1:39266693-39266715 CTGCTTTCTGCTGTGTGGCCTGG + Intronic
905625836 1:39490431-39490453 AGCTCCACTGCTGTGTGACCTGG + Intergenic
905647764 1:39636200-39636222 CTCTAATTTGCTGTGTGGCCTGG - Intronic
905862468 1:41360917-41360939 CTCTGCTCTTCTTTGTGCCCTGG - Intergenic
906672666 1:47667887-47667909 CACTTCTTAGCTGAGTGACCTGG + Intergenic
906680412 1:47722419-47722441 CTCTGGCTTGCTGTGTGACCTGG + Intergenic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
907165075 1:52403523-52403545 CTCGTCTCTGCTGTGTTAGGTGG - Intronic
907243263 1:53092279-53092301 CTCTACTGTGCTGTCTGCCCTGG + Intronic
907359656 1:53904245-53904267 CACTGACCTGCTGTGTGACCTGG + Intronic
907914982 1:58860405-58860427 TTCTGCTCTGCTCTGTGCCCAGG - Intergenic
908600035 1:65728607-65728629 CTCTTGTCTGATCTGTGTCCAGG - Intergenic
908787787 1:67752288-67752310 CTCTTCTCTCCAGTGAGACCTGG - Intronic
909499567 1:76318983-76319005 GTCTTTTTTGTTGTGTGACCTGG + Intronic
910210605 1:84788907-84788929 CTCTTCTCTCTTCTGTTACCTGG - Intergenic
911274750 1:95848105-95848127 CTGTTCTCTGCTCAGTGGCCTGG + Intergenic
911958350 1:104266022-104266044 CTCTACCCTACTCTGTGACCAGG + Intergenic
912543010 1:110431132-110431154 CTTTGCCCTGCTGTGTGTCCTGG + Intergenic
915006738 1:152645267-152645289 CTGTGCTCTTTTGTGTGACCAGG - Intergenic
915123749 1:153649157-153649179 CTCTTCTCTGTTGTCTGAACTGG - Intergenic
915467730 1:156107041-156107063 CACTTGTCAGCTGTGTGGCCTGG + Intronic
916832690 1:168509342-168509364 CTCCTCTCTGATGTGTTAACTGG + Intergenic
917564221 1:176195078-176195100 CTCTTCTCTTCTTTGAGACAGGG - Intronic
918390654 1:184057005-184057027 CTCTTCCCTTGAGTGTGACCTGG + Intronic
919092885 1:192995340-192995362 CTTTTCTCTTCTCTGTGGCCTGG - Intergenic
919505878 1:198397198-198397220 TTCTTCTTTGCTGTGTGGACTGG + Intergenic
919726437 1:200887740-200887762 ATCTGCTCTTCTGTGTGCCCTGG - Intergenic
919818309 1:201456003-201456025 CTCCTCCCTGCTGTGTCTCCTGG - Intergenic
920232727 1:204481213-204481235 CTCTTCTCTTCTGGGAGAGCTGG - Intronic
920414994 1:205793210-205793232 CTCCTCCCAGCTGTGTGTCCTGG - Intronic
920512872 1:206563829-206563851 CTCTACTGAGCTGTGTGACTGGG - Intronic
920849968 1:209622139-209622161 CTCTTCTCTGCTTTGTTCACTGG - Intronic
921815226 1:219555977-219555999 CTCTTCTCTGCTTTATGAAAAGG - Intergenic
922100149 1:222472710-222472732 TTCTTCCCTGCTGTGTCTCCAGG - Intergenic
922240053 1:223749519-223749541 CTCTTACCAGCTGTGTGGCCTGG + Intronic
922969602 1:229724900-229724922 CTATTTTCTGCTGTGTGACAGGG - Intergenic
923219717 1:231882037-231882059 CTCCTCCCTGCTGTGGGCCCAGG + Intronic
924613287 1:245591246-245591268 CTCTTGGTCGCTGTGTGACCAGG - Intronic
1063505227 10:6591811-6591833 CTGTTATCTGCTGTGGGAGCAGG + Intergenic
1064408063 10:15081985-15082007 CTCTTAAGAGCTGTGTGACCAGG + Intronic
1064486101 10:15792199-15792221 CTCAGCTCTGGTGTGTGACTTGG - Intronic
1065641567 10:27787555-27787577 CTCTTCTTTGCTTTCTGTCCTGG + Intergenic
1066322470 10:34317853-34317875 ATCTGCTCTTCTGTGTGAGCAGG - Intronic
1067576457 10:47411813-47411835 CTCTTCCCCGCTGAGTGCCCGGG + Intergenic
1068135563 10:52948981-52949003 CTCTTTTCAGCAGGGTGACCTGG - Intergenic
1068829178 10:61473295-61473317 CTCTGCTCTGCTTTATGGCCAGG + Intergenic
1068869450 10:61927905-61927927 CTTTTCTCTGCTTTCTGCCCTGG + Intronic
1068917077 10:62444214-62444236 CTCTGCTCTTCTCTGTGCCCTGG + Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1070725432 10:78784479-78784501 CTCTTACCAGCTTTGTGACCTGG - Intergenic
1070737091 10:78870573-78870595 CTCATCTTTCCTGTGTGGCCTGG + Intergenic
1070754896 10:78985814-78985836 CACTGACCTGCTGTGTGACCTGG - Intergenic
1070978597 10:80626491-80626513 CTCTCCTCTCCTGTGGGACTCGG + Intronic
1071504293 10:86223346-86223368 TCCTTCTCTGGTGTGTGTCCTGG - Intronic
1072531897 10:96327486-96327508 ACCTTGTCAGCTGTGTGACCAGG + Exonic
1072553582 10:96497417-96497439 CTCCACTCTGCTCTGTGTCCAGG + Intronic
1072810016 10:98454340-98454362 CTTTTCTCTGCTGTGTGCATAGG + Intergenic
1072835891 10:98711505-98711527 CACTTATCTGATTTGTGACCTGG + Intronic
1073616173 10:104998451-104998473 CTCTGCTCAGCTGTGAGGCCTGG - Intronic
1074189325 10:111122425-111122447 CTCTGCTCTGCTTTCTGTCCAGG - Intergenic
1074862703 10:117524404-117524426 CACTTCCTTGCTATGTGACCAGG - Intergenic
1075336212 10:121610485-121610507 CTTCTCTTTGCTGTGTGACCTGG + Intergenic
1077466796 11:2737235-2737257 CACTTCTGTGCTGGGTGCCCTGG - Intronic
1077551736 11:3203466-3203488 CTCTGCTCTGCTGCCTGTCCGGG + Intergenic
1078119351 11:8490537-8490559 CTCTTCACAGCTGTGAGACGGGG - Intronic
1078488143 11:11742856-11742878 CACTTCTTAGCTGTGTGACTTGG + Intergenic
1078596781 11:12694059-12694081 CCCTGCTCTGCTGTGCGGCCCGG + Intronic
1078822334 11:14894579-14894601 CTCTCCTCTGCTATGTAGCCAGG - Intergenic
1078857853 11:15221092-15221114 CTCTTCCTTGCTGTGTGACTTGG - Intronic
1079292048 11:19197062-19197084 CTCTTCGAAGCTGTGTGATCTGG + Intronic
1079458615 11:20659869-20659891 ATGTTCTCTGCTGTCTGATCAGG + Intergenic
1079520582 11:21321709-21321731 CACTTATCAGCTGTGTGGCCTGG - Intronic
1080117166 11:28634059-28634081 CTCTTCCCTGCTGTATGCCTGGG + Intergenic
1080222434 11:29921602-29921624 CTCTGCTCTACTCAGTGACCAGG + Intergenic
1080295134 11:30717967-30717989 CTCTTCTCTTCAGTTTGACCTGG + Intergenic
1080523318 11:33087770-33087792 TTCTTATTAGCTGTGTGACCTGG - Intronic
1080855314 11:36106808-36106830 CCTCCCTCTGCTGTGTGACCTGG + Intronic
1080868347 11:36214701-36214723 CACTTCCTGGCTGTGTGACCTGG + Intronic
1081516705 11:43838783-43838805 TTCTTCTATGCTGTGTGAAGTGG - Intronic
1081589333 11:44410083-44410105 CACCACTCCGCTGTGTGACCTGG + Intergenic
1081649182 11:44812215-44812237 CACTTCCTGGCTGTGTGACCTGG + Intronic
1083387909 11:62325709-62325731 CTCTTCACTGCCCTTTGACCTGG + Intergenic
1083397308 11:62400720-62400742 CACTTACCTGCTGTGTGACGCGG - Intergenic
1083881175 11:65548993-65549015 CACGGCTCAGCTGTGTGACCTGG + Intronic
1084340394 11:68495130-68495152 CACTTCCCTACTGTGTTACCTGG + Intronic
1085692413 11:78674428-78674450 TTCCTCTCTGCTGTGTGAACTGG - Intronic
1085706178 11:78788460-78788482 AGCTTCTGAGCTGTGTGACCTGG + Intronic
1085739310 11:79065323-79065345 CTCTACTGTGCAGTATGACCAGG - Intronic
1085757794 11:79216031-79216053 CTCTTCATTGCTGTGGGACCAGG - Intronic
1086432777 11:86751533-86751555 CTCTTCTCTGCAGTGTGGGCAGG - Intergenic
1086747725 11:90451254-90451276 CCTTTCTCTGCAGTGTGACAAGG - Intergenic
1086850731 11:91804420-91804442 CTCTCCCCTGCTGTGTGATCAGG - Intergenic
1086921376 11:92591262-92591284 CTCTTCTCTGAAGTAAGACCAGG + Intronic
1087892359 11:103550064-103550086 TTCTCCTCCTCTGTGTGACCTGG + Intergenic
1088323627 11:108579634-108579656 CTGTTCTGTGCCTTGTGACCAGG - Intronic
1088560335 11:111108812-111108834 CTCTTCTCTGTACTGCGACCCGG - Intergenic
1088704083 11:112445800-112445822 TCCTTCTCTGCTCTGTGGCCTGG + Intergenic
1088794762 11:113258415-113258437 CTATTCCATGCAGTGTGACCTGG - Intronic
1088908779 11:114174861-114174883 CTCTTCCCTGCAGCTTGACCTGG - Intronic
1089073109 11:115716429-115716451 CTTTTCACAGCTGAGTGACCTGG + Intergenic
1089096807 11:115926407-115926429 CTCTTCTCTGTCCTGTCACCTGG + Intergenic
1089234375 11:117010555-117010577 CTCTTCTCTGCTGGCTTATCAGG + Intronic
1089455421 11:118622858-118622880 CTCTTCTCTGATTGGTGACTTGG + Intronic
1089460754 11:118652068-118652090 CTCTTCCCAGCTGTGTGGCTAGG - Intronic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1090880619 11:130828927-130828949 CATTTCTCTGCTATTTGACCTGG + Intergenic
1091038825 11:132257532-132257554 CTCTGCCCTGCAGTGTGGCCTGG + Intronic
1091383999 12:80740-80762 CTCTTCTCTGCTTTTTCTCCAGG - Intronic
1092156428 12:6284683-6284705 CACTTCCTAGCTGTGTGACCCGG + Intergenic
1092996211 12:13953368-13953390 TTCTCCTCTGCAATGTGACCTGG - Intronic
1093423561 12:19001796-19001818 CTCTTTACTACTGTGTGACCTGG - Intergenic
1095290424 12:40473224-40473246 GTCTTACCTGCTGTGTTACCAGG - Exonic
1095425430 12:42069829-42069851 CTTTTCTTTGGTGTGTGACATGG - Intergenic
1096216494 12:49800667-49800689 TACTTCTTAGCTGTGTGACCTGG - Intronic
1096738650 12:53676052-53676074 GTCTTCTCTGCAGTGGGAGCAGG - Exonic
1097052169 12:56230187-56230209 CTCTCCTCTGATGTCTGACCTGG - Intronic
1097184135 12:57187573-57187595 CCCTTCCCTGCTGTGTGATCTGG + Intronic
1097861375 12:64521818-64521840 CTCTTTAAAGCTGTGTGACCTGG - Intergenic
1097901158 12:64875126-64875148 ATTTTCCCTCCTGTGTGACCAGG - Exonic
1098234160 12:68402327-68402349 CTCTTCCCTGAACTGTGACCAGG - Intergenic
1098405176 12:70117496-70117518 CTCTTACCAGCTTTGTGACCTGG + Intergenic
1100090395 12:90961337-90961359 CTCTTCTCTGATTTGTGACTTGG + Intergenic
1100788017 12:98099529-98099551 CATTTCTCTGCTGTGTTAGCAGG - Intergenic
1101214595 12:102567713-102567735 CCCTTACCAGCTGTGTGACCTGG - Intergenic
1102508555 12:113399067-113399089 CTGTCCTCTGCTGTGTGTCCTGG - Intronic
1102981060 12:117241858-117241880 CTCTCCACTGCACTGTGACCAGG + Intronic
1103715370 12:122942122-122942144 CACTTCTAGGCTCTGTGACCTGG - Intronic
1103763807 12:123268438-123268460 CTCCTCTATGCTGTGTGCCCTGG - Intronic
1104701180 12:130905295-130905317 CTCTTACCAGCTGTGTGCCCAGG + Intergenic
1106091602 13:26600311-26600333 CTATTATGTACTGTGTGACCTGG + Intronic
1106218536 13:27724776-27724798 CTATTCTCTGCTGTGTAGCCAGG - Intergenic
1106460079 13:29960797-29960819 AACCTCTCTGCTCTGTGACCTGG - Intergenic
1107604847 13:42047996-42048018 CTCTTCTCTTCCGTGTGCGCCGG + Intronic
1109276739 13:60311903-60311925 CCCTTCTCTGCTCTGTGCCATGG - Intergenic
1109549346 13:63872962-63872984 ACCTCCTCTGCTGTGTGGCCTGG + Intergenic
1110301966 13:73939089-73939111 CTCTTCTCTCCTGTAGAACCAGG - Intronic
1110311048 13:74049412-74049434 CTCTTCTCAGCAGAGTCACCTGG - Intronic
1110789767 13:79574949-79574971 ACCTTCTCTGCTGTCTGACTAGG - Intergenic
1111650947 13:91090711-91090733 CTCTCACCAGCTGTGTGACCTGG + Intergenic
1113542930 13:111122983-111123005 CTCCACTCTGCTTTGTGTCCTGG - Intronic
1113897877 13:113777350-113777372 CTCTTGCCAGCTATGTGACCTGG + Intronic
1115894675 14:38073046-38073068 CTCTTCTCTTGTGTGTAAGCTGG + Intergenic
1118052322 14:62042831-62042853 CTCTTCTCTGAGCTGTGGCCTGG + Intronic
1118739394 14:68728087-68728109 CTCTTCTCTCCTCTGTCTCCAGG + Intronic
1119932073 14:78557055-78557077 CTCTTCTCTTTTCTGAGACCGGG + Intronic
1120563234 14:86022577-86022599 CTCTTCCCTGCTTTCTGCCCTGG + Intergenic
1121422063 14:93823393-93823415 CCTTTCTCAGCTGTGTGACCTGG - Intergenic
1121873252 14:97428537-97428559 CACCTTTCTGCTGTGTTACCGGG + Intergenic
1123759624 15:23422427-23422449 CCCCTCGATGCTGTGTGACCCGG - Intergenic
1124022973 15:25940536-25940558 TTCTTCTCTGCAGCGTGACATGG + Intergenic
1124215011 15:27799265-27799287 GTGTTCACTGCTGTGTGCCCAGG - Intronic
1124937031 15:34183201-34183223 CTCCTCTCAGCTGTGTGGGCTGG + Intronic
1125178306 15:36851551-36851573 TTCTACCCTGCTGTGTGGCCTGG + Intergenic
1125460125 15:39898514-39898536 CTCTTCTCTGCTTTGTTCACTGG - Intronic
1125574705 15:40747310-40747332 CTCTTCTTGGCTTTGTGAGCTGG - Intronic
1125591532 15:40857347-40857369 CTCTTCCATGCTGTGCGCCCAGG + Exonic
1127261367 15:57329095-57329117 AGCTTCTCTGCTGTGTCTCCCGG + Intergenic
1127960816 15:63888980-63889002 CTCTCCCCAGCTGTGTGACCTGG + Intergenic
1129219583 15:74123667-74123689 CTCTTCTCTGCCATGGGACTGGG + Intronic
1129704543 15:77786775-77786797 TTCTTCTTTGCTTAGTGACCTGG + Intronic
1129734342 15:77951504-77951526 CTGTTCTCTGCTGGGGTACCTGG - Intergenic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1129841244 15:78744487-78744509 CTGTTCTCTGCTGGGGTACCTGG + Intergenic
1130427514 15:83816175-83816197 TTCTTCTTTGCTGTGGGAACTGG + Intronic
1131204893 15:90435656-90435678 CACTACTCTGCAGTGTAACCTGG + Intronic
1131471631 15:92702678-92702700 CACTTCTTAGCTGTTTGACCAGG - Intronic
1132869763 16:2110689-2110711 CTGTTCTCTGCTGTGGGCCGTGG - Exonic
1132973200 16:2698874-2698896 TTTTTCCCTGTTGTGTGACCGGG + Intronic
1133756039 16:8763252-8763274 CCCTTCTTGGCTGTGTGACTTGG + Intronic
1133863174 16:9616232-9616254 CTCCACTCTGCTCTGTGACCTGG + Intergenic
1134456722 16:14400469-14400491 CCCCTCGATGCTGTGTGACCCGG + Intergenic
1134492819 16:14708364-14708386 CACTTATCAGCTGTGTGATCTGG - Intergenic
1134498200 16:14747486-14747508 CACTTATCAGCTGTGTGATCTGG - Intronic
1134504078 16:14791143-14791165 CTCTTTTCCTCCGTGTGACCTGG + Intronic
1134576494 16:15337765-15337787 CTCTTTTCCTCCGTGTGACCTGG - Intergenic
1134582374 16:15381607-15381629 CACTTATCAGCTGTGTGATCTGG + Intergenic
1134717658 16:16364912-16364934 CTGTTCTCTGCTGTGGGCCGTGG + Intergenic
1134725949 16:16418734-16418756 CTCTTTTCCTCCGTGTGACCTGG + Intergenic
1134957094 16:18387247-18387269 CTGTTCTCTGCTGTGGGCCGTGG - Intergenic
1135313692 16:21425657-21425679 CACTTATCAGCTGTGTGATCTGG + Intronic
1135366616 16:21857937-21857959 CACTTATCAGCTGTGTGATCTGG + Intronic
1135445199 16:22513221-22513243 CACTTATCAGCTGTGTGATCTGG - Intronic
1135885178 16:26299531-26299553 CTCTTCTCTACTTTGAGTCCTGG + Intergenic
1136076977 16:27823855-27823877 CACTTACCAGCTGTGTGACCTGG + Intronic
1136152831 16:28363380-28363402 CACTTATCAGCTGTGTGATCTGG + Exonic
1136193920 16:28637760-28637782 CACTTATCAGCTGTGTGATCTGG - Exonic
1136210252 16:28751893-28751915 CACTTATCAGCTGTGTGATCTGG - Exonic
1136310355 16:29404360-29404382 CACTTATCAGCTGTGTGATCTGG + Intergenic
1136323804 16:29506151-29506173 CACTTATCAGCTGTGTGATCTGG + Intergenic
1136387905 16:29941486-29941508 CTCTTCTCTGCTGTTGGCCAAGG + Intronic
1136438489 16:30246132-30246154 CACTTATCAGCTGTGTGATCTGG + Intronic
1136598310 16:31266722-31266744 CCCTCCTCTGCAGTGTGACCTGG - Intronic
1136604495 16:31324297-31324319 TGCTTCTCAGCTGTGTGACTTGG - Intronic
1136687646 16:32004436-32004458 CTCTTCTTTGTTGTGTGCTCGGG + Intergenic
1136788255 16:32947986-32948008 CTCTTCTTTGTTGTGTGCTCGGG + Intergenic
1137005258 16:35269931-35269953 CTCTTTCCAGCTGGGTGACCTGG - Intergenic
1137610734 16:49815528-49815550 CTCCTGTTTGCTGTGTGACTTGG - Intronic
1137667430 16:50259889-50259911 CTCTTCTCAGCTGTGGGCTCAGG - Intronic
1138183641 16:54960255-54960277 CATTTGTCAGCTGTGTGACCTGG - Intergenic
1138416692 16:56875730-56875752 CTCTTCCCTGCTGTGTGCACTGG - Intronic
1138418701 16:56885912-56885934 CACTTGCCAGCTGTGTGACCTGG - Intronic
1138585358 16:57966288-57966310 CTCTTGTCTGCTGAGTCCCCGGG + Intronic
1139020828 16:62746933-62746955 ATCTTCTCTGCTCTCTGTCCTGG - Intergenic
1139091014 16:63647572-63647594 CTCTTCTCTGCTTTATGGCTTGG + Intergenic
1139339524 16:66259013-66259035 CACTTCCCAGCTGTGTGACCTGG - Intergenic
1139350075 16:66329379-66329401 CTCTTCTCAGCTCAGTGGCCTGG - Intergenic
1139356614 16:66370753-66370775 CTCTTCTTTGCTGTGTTTCCTGG - Intronic
1139858038 16:69996747-69996769 CACTTATCAGCTGTGTGATCTGG + Intergenic
1139935692 16:70569342-70569364 CTCTGCTCTGAGGTGTGTCCTGG + Intronic
1141146705 16:81536004-81536026 CTCTTGTCTGCTGTGTGCTGTGG + Intronic
1141426829 16:83949657-83949679 CTCAGGTGTGCTGTGTGACCTGG - Intronic
1141647387 16:85375024-85375046 CCACTCGCTGCTGTGTGACCTGG + Intergenic
1141670169 16:85487580-85487602 CCGTTCTCAGCTGTGTGACCTGG - Intergenic
1141829446 16:86501579-86501601 CGCTCCACTGCTGTGTGACATGG - Intergenic
1142429086 16:90016756-90016778 CTGTTCCCTGTTGTGTGCCCAGG + Intronic
1142612382 17:1116358-1116380 CTCTTGCCAACTGTGTGACCTGG + Intronic
1143734135 17:8898527-8898549 CTCTTGTCAGCTATGTGACCTGG + Intronic
1144150274 17:12436344-12436366 CTCTTATTAGCTGTGTGACCTGG - Intergenic
1144181512 17:12756600-12756622 CTCTTCTCTCTTCTGTAACCCGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144969179 17:19096466-19096488 CACTTTCCAGCTGTGTGACCTGG - Intronic
1144978737 17:19155600-19155622 CACTTTCCAGCTGTGTGACCTGG + Intronic
1144989485 17:19222632-19222654 CACTTTCCAGCTGTGTGACCTGG - Intronic
1145010242 17:19363880-19363902 CTCTTGTCAGATGTGTGAACTGG - Intronic
1145738366 17:27249802-27249824 CTCTTCAGTGCTGTGAGACAGGG - Intergenic
1145788391 17:27609004-27609026 TTCTTCACTGCTGTGTGGCTTGG + Intronic
1145888876 17:28400830-28400852 CACCTCACAGCTGTGTGACCGGG + Exonic
1146533734 17:33632084-33632106 CACTTATTAGCTGTGTGACCTGG + Intronic
1146626430 17:34438745-34438767 CCATTCCTTGCTGTGTGACCTGG + Intergenic
1146627333 17:34444635-34444657 CTCTTATTTACTATGTGACCTGG - Intergenic
1146915514 17:36676019-36676041 CTCCTCCCAGCTGTGTGTCCTGG + Intergenic
1147148631 17:38500105-38500127 CTCTTCTCTGTTGTGTGCTCGGG + Intronic
1148233668 17:45952942-45952964 CTCTTACTGGCTGTGTGACCTGG + Intronic
1148395121 17:47301986-47302008 CACTCATTTGCTGTGTGACCTGG + Intronic
1148678150 17:49457015-49457037 CTCTTCTCTGGGGTGTGCCTGGG + Intronic
1149403553 17:56323800-56323822 TTATTCTCTGCTGTATGTCCAGG - Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1149988426 17:61366323-61366345 CTCTTCACTCCTGTGAGACAGGG + Intronic
1150839255 17:68592798-68592820 CTCTACTATGCTGTGTTCCCTGG + Intronic
1152008902 17:77698641-77698663 CTCTCCTCCTCTGTGTGCCCAGG + Intergenic
1153396899 18:4632790-4632812 CCCTTCCCTGCACTGTGACCTGG - Intergenic
1154119485 18:11640019-11640041 CACTTATCAGCTGTGTGATCTGG + Intergenic
1154390810 18:13934566-13934588 CTCTTCTCTGCAGTGTGGGCAGG + Intergenic
1155787164 18:29915245-29915267 CTCTTCTCTGCTCTGTCAGTGGG - Intergenic
1156455293 18:37289817-37289839 GCCTTCTCTGTTGTGTGACATGG + Intronic
1157546856 18:48552743-48552765 CACTTCTTAGCTGTGTGGCCTGG - Intronic
1157710465 18:49846634-49846656 TGCTTCCCAGCTGTGTGACCTGG + Intronic
1158058414 18:53310078-53310100 CTCTCCCCTGCTCTGTGACTGGG + Intronic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1160750404 19:731389-731411 CACTTCCCAGCTGTGTGAGCCGG + Intronic
1161271220 19:3390389-3390411 CTCTTGTCTGCTGTGGGAGCTGG - Intronic
1161658483 19:5530727-5530749 CACTTCTTGGCTGTGTGACCAGG + Intergenic
1162673817 19:12283203-12283225 CTCTGCTCTGGTGTGTCTCCAGG - Intronic
1162938677 19:13995164-13995186 CACTTCCCCGCTGTGTGGCCTGG - Intronic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228018 19:15978876-15978898 CTCGGTTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163262573 19:16199966-16199988 TGCTGCTCAGCTGTGTGACCTGG + Intronic
1163469902 19:17489984-17490006 CCCTGCTCAGCTGTGTGACCTGG - Intronic
1165272836 19:34725140-34725162 CTCTTTCCAGCTGGGTGACCTGG + Intergenic
1165313812 19:35042901-35042923 ATCTTTTTTGCTGTGTGATCTGG + Intronic
1165435044 19:35790826-35790848 CACTGCTGGGCTGTGTGACCTGG - Intergenic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1166859063 19:45799253-45799275 CTCTGCCCTGCTGCGTGACAGGG - Intronic
1166972705 19:46580470-46580492 TACTTCCCAGCTGTGTGACCTGG - Intronic
1167117561 19:47497099-47497121 CTCTCCTCTGCAGCGTGGCCCGG - Intronic
1167267258 19:48489760-48489782 CATTTCTTAGCTGTGTGACCTGG - Intronic
1167285563 19:48596954-48596976 CACTGCCCGGCTGTGTGACCTGG + Intronic
1167293937 19:48638652-48638674 CTCTTCACTGCTTTGTAACTTGG - Intronic
1167528519 19:50000549-50000571 TGCTTCCCTGCTGTGTGACCTGG - Intronic
1168060334 19:53888533-53888555 CGCTTCTCAGCTGTGTGATTTGG - Intronic
1168065264 19:53915580-53915602 CACTTCCTTGCTGTGTGGCCTGG + Intronic
1168444905 19:56403751-56403773 TTGTTCACTGCTGTGTGCCCAGG + Intronic
1168707441 19:58477999-58478021 AGCTCCTCTGCTGTGTGACATGG - Intronic
925634678 2:5931824-5931846 CCCTTCTTAGCTCTGTGACCCGG - Intergenic
925844396 2:8022413-8022435 GCCTTCTCTCCTGTGTGACTAGG - Intergenic
926142419 2:10375627-10375649 CTGTTAGCAGCTGTGTGACCTGG + Intronic
926174539 2:10578205-10578227 CTCTTCTCTGTGGCTTGACCTGG - Intronic
926710453 2:15875409-15875431 CTCTTCTGGGCTCTGTGACTAGG - Intergenic
926783559 2:16498079-16498101 CTCGTCCCTGCTCTGTGCCCTGG - Intergenic
927138900 2:20116341-20116363 CCCTTGCCTGCTGTGTGACCTGG + Intergenic
927248404 2:20976703-20976725 CCCTTCTCAGCTGTGTGTCTTGG + Intergenic
927436766 2:23073371-23073393 CTCTGCTTTTCTGTGTGAGCTGG - Intergenic
927444700 2:23148841-23148863 CTCTTCTCTGCCTAGTGAACGGG - Intergenic
928195767 2:29215561-29215583 CGCTTATTAGCTGTGTGACCTGG - Intronic
928620399 2:33082817-33082839 CTCCTCTCTGCCTTGTGTCCTGG + Intronic
929053306 2:37855958-37855980 CTTTTCTCTCCTGTGTCTCCTGG - Intergenic
929191067 2:39140433-39140455 CACTGCTTAGCTGTGTGACCTGG - Intergenic
930371631 2:50509122-50509144 CACTTTTTAGCTGTGTGACCTGG - Intronic
930611185 2:53545770-53545792 CTGTTCACTGCTGTGACACCAGG - Intronic
931218452 2:60267385-60267407 CTCTTCTCCTCTGCGTGCCCCGG - Intergenic
931819268 2:65935175-65935197 CTTTTCTCCTCTGTGTGTCCTGG - Intergenic
932196135 2:69785701-69785723 CTCTTTCTAGCTGTGTGACCTGG - Intronic
933750694 2:85600741-85600763 CGCTTATTAGCTGTGTGACCTGG + Intronic
934729985 2:96650333-96650355 CTCTTGTTTGCTGTGTTCCCAGG + Intergenic
935069378 2:99680423-99680445 CTGTCCTCTGCTGTCTGCCCGGG - Intronic
935129435 2:100250386-100250408 CACTGTTCTGCTGTGTGACCTGG - Intergenic
935290343 2:101604863-101604885 CTCTTGCCATCTGTGTGACCAGG - Intergenic
936226580 2:110659546-110659568 CACTTCTCCGCTGTGTGACTGGG - Intronic
937082380 2:119149675-119149697 CTTTACTCTGCATTGTGACCTGG + Intergenic
938911893 2:135893143-135893165 TTCCACTCTGCTGTGTGTCCTGG - Intergenic
940000642 2:148963697-148963719 CAGTTCTCTGTTGGGTGACCAGG + Intronic
940368581 2:152876236-152876258 TTCTTCTCTGCTTTGGGCCCTGG + Intergenic
942040983 2:172062580-172062602 CTCCACTCTGCTCTGTGATCTGG - Intronic
944150516 2:196553425-196553447 TTATTCTCTACTGTGTGCCCAGG - Intronic
946234010 2:218311181-218311203 ATCTAATCAGCTGTGTGACCTGG + Intronic
946641553 2:221788952-221788974 CTCCACTCTGCTCTGTGCCCTGG - Intergenic
946738186 2:222775348-222775370 CTCTGTTCTGCTCTGTGCCCTGG + Intergenic
947659382 2:231855404-231855426 CTCTCCTCTCCTGTGTAACCAGG + Intergenic
947831981 2:233147923-233147945 CACTTAGCAGCTGTGTGACCTGG + Intronic
948022998 2:234752440-234752462 CAATTCTCAGCTGTGAGACCAGG + Intergenic
948157030 2:235791832-235791854 CTCTTCCCGGCTGGGTGAGCTGG - Intronic
948232085 2:236356134-236356156 CTCCCCTCTGCTTGGTGACCTGG - Intronic
948850699 2:240704017-240704039 GACTTCACTGCTGAGTGACCCGG - Intergenic
1168843906 20:928906-928928 ATATTCTCTCCTGTTTGACCAGG - Intergenic
1168845659 20:942816-942838 CTCTAACTTGCTGTGTGACCTGG + Intergenic
1168867840 20:1104489-1104511 CACTTGTTGGCTGTGTGACCTGG - Intergenic
1169602356 20:7276104-7276126 CTTCTCACAGCTGTGTGACCTGG + Intergenic
1169766182 20:9150689-9150711 CACTTCTTGGCTGGGTGACCTGG - Intronic
1170311229 20:14994496-14994518 CTCTGCTCTGCTTTTTGACTGGG - Intronic
1170662999 20:18360833-18360855 CTCTGCTATGCTGTGTCAGCAGG - Intergenic
1170828549 20:19819279-19819301 CTTCTCTCTGCTGTGTGAGAAGG - Intergenic
1171005615 20:21462703-21462725 CCCTGCTCTGCTCTGTGCCCTGG - Intergenic
1172188228 20:33044825-33044847 CTCCTCTTTGCTGTGTGTCCTGG + Intergenic
1172561365 20:35891520-35891542 ATCTTTTCTGCTGAGAGACCGGG + Intronic
1172842260 20:37909089-37909111 CTCTTCCCCTCTGTGTGACGTGG - Intronic
1172870315 20:38131538-38131560 CTCTTCTTCACTGTGTGACCTGG + Intronic
1172872284 20:38143266-38143288 CTGCTTTCAGCTGTGTGACCTGG + Intronic
1173196019 20:40913437-40913459 CTCTTCTTTCCTGTGTCTCCCGG + Intergenic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1173761361 20:45563440-45563462 CACTTATCGGCTGTGTGGCCTGG + Intronic
1173854151 20:46239182-46239204 CTTTTCACTGCTGTGTTCCCAGG + Intronic
1173978788 20:47207216-47207238 CTGTTCCCTGCTGTGTCCCCAGG - Intergenic
1174422487 20:50408696-50408718 CACCTCTTGGCTGTGTGACCTGG - Intergenic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1174863893 20:54117012-54117034 CACTTAATTGCTGTGTGACCTGG + Intergenic
1175271593 20:57737778-57737800 CTGTTCTCTGCTGGGAGTCCTGG + Intergenic
1176295431 21:5069632-5069654 CTATTTTCAGCTGTGTGTCCAGG + Intergenic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1177349937 21:19924497-19924519 TTCGTCTCTGCTTTGTGCCCTGG - Intergenic
1177995739 21:28095037-28095059 CTCATCTCTGCTCTTAGACCTGG - Intergenic
1178158352 21:29881462-29881484 CACTTATCTGCTGTGTGGTCTGG - Intronic
1178376058 21:32068298-32068320 TTCTTATTAGCTGTGTGACCAGG - Intergenic
1178430763 21:32516923-32516945 CACTTCCCAGCTGTGTGACGTGG - Intergenic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1179861619 21:44192492-44192514 CTATTTTCAGCTGTGTGTCCAGG - Intergenic
1180247732 21:46559506-46559528 ATCTCCTCTGCTGCGTGACAAGG - Intronic
1180642708 22:17311798-17311820 CTCTTCTCTACTGTGAGCCTGGG - Intergenic
1181470584 22:23136914-23136936 CTCTTTCCTGCTCTGTGATCTGG - Intronic
1181509967 22:23384760-23384782 GACTTCTCAGCTGTGTGTCCTGG + Intergenic
1181520737 22:23448210-23448232 CTCTTATCTGCTGTGGGCCCTGG - Intergenic
1181776980 22:25166779-25166801 CTCTGCCCAGCTGTGTGGCCTGG - Intronic
1182079314 22:27518008-27518030 CTCCACTCTGCTGTGTGGCCTGG - Intergenic
1182110966 22:27723255-27723277 CATTTGTCAGCTGTGTGACCTGG + Intergenic
1182281084 22:29218020-29218042 CTGCACTCTGCTGTGTGACTTGG + Intronic
1182302626 22:29346154-29346176 CTCCTCCCTGTTGTGTGGCCTGG - Intronic
1182584921 22:31339460-31339482 CTCTCCTGGGTTGTGTGACCAGG - Intronic
1183445048 22:37848083-37848105 CACTGATTTGCTGTGTGACCAGG - Intronic
1183739364 22:39661618-39661640 CACTTCCAAGCTGTGTGACCAGG + Intronic
1183770497 22:39921238-39921260 GGTTTCTCAGCTGTGTGACCTGG + Intronic
1184087809 22:42275719-42275741 CTCTTCCTAGCTGTGTGACCTGG - Intronic
1184639882 22:45864879-45864901 TGCTTCTTTGCTGTGTGTCCTGG - Intergenic
1185117823 22:48947984-48948006 CTCTGCTCCGCTCTGTCACCCGG + Intergenic
949349429 3:3110525-3110547 CTCTTCTCTGCTTTGTGAGCAGG + Intronic
949895592 3:8765756-8765778 CTCTGACTTGCTGTGTGACCTGG + Intronic
951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG + Intronic
952527945 3:34232306-34232328 CACTTATCAGCTGTTTGACCTGG + Intergenic
953691282 3:45122044-45122066 TTCTTCTCTGTTGTTTGGCCAGG + Intronic
954979952 3:54736827-54736849 CATTTGCCTGCTGTGTGACCTGG + Intronic
955691090 3:61591445-61591467 CTCCTATCTGCTGTGTCACTGGG + Intronic
956113300 3:65892994-65893016 TCCTTCTCTGGTGTGTTACCTGG - Intronic
956739099 3:72260981-72261003 CTCTACCCTGCTCTGTGTCCTGG + Intergenic
961380734 3:126495016-126495038 GTATCCTCAGCTGTGTGACCTGG - Intronic
961391865 3:126557214-126557236 CTATCCTCTGCTGCGTGACCTGG + Intronic
961485077 3:127210530-127210552 CTCTGAGCTGCTGTGTGACTTGG + Intergenic
961754391 3:129119468-129119490 CACTTCTTAGCTGTGTGCCCAGG + Intronic
962819935 3:139038702-139038724 CTTTTCTCTGCTGTCTGCCTTGG + Intronic
963231359 3:142911481-142911503 CCCTTCTGTGCTTTGTGAACTGG + Intergenic
964078193 3:152718434-152718456 CCCTTGTCTGCGGTGAGACCTGG + Intergenic
964540537 3:157774649-157774671 TTCTTCTCTGCTGTTTCTCCAGG - Intergenic
964736806 3:159926484-159926506 CTCTTCTCTACTGTGTGCCATGG - Intergenic
965547888 3:169934109-169934131 GTCTTCTGGGCTCTGTGACCTGG - Intronic
966081537 3:176009672-176009694 ATCTTATTAGCTGTGTGACCGGG + Intergenic
966943809 3:184763522-184763544 CTCTCTGCTTCTGTGTGACCAGG + Intergenic
967945164 3:194798345-194798367 GTTGGCTCTGCTGTGTGACCTGG - Intergenic
968544559 4:1192107-1192129 CTGTCCACGGCTGTGTGACCCGG + Intronic
968705418 4:2075307-2075329 CTCATTGCTGCTGTGTCACCTGG - Intronic
968902471 4:3438151-3438173 CTCCTGTCTGCTGTGGGCCCAGG + Intronic
969101892 4:4775623-4775645 CTCCTGCCTGGTGTGTGACCCGG - Intergenic
969578178 4:8048520-8048542 CTCCTCCCAGCTGTGTGACCTGG - Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
970369576 4:15393643-15393665 AGCTTCCTTGCTGTGTGACCTGG + Intronic
970481164 4:16476745-16476767 TTCTTCTCTTCTGTGTGCCCTGG - Intergenic
971253556 4:24993287-24993309 CACTCTTCAGCTGTGTGACCCGG + Intergenic
973821219 4:54663267-54663289 CTCTTCCCTGCTGTGTGCTCTGG + Intronic
974293672 4:59966983-59967005 CTCTTCTCTGGGGCATGACCAGG - Intergenic
977586866 4:98783807-98783829 CTCTCTGCTGCTGTGTGTCCTGG - Intergenic
978396307 4:108284097-108284119 CTCTTCTCTCCTCCCTGACCTGG - Intergenic
979544449 4:121923790-121923812 GTCTTTTCTGCAGTGTGACATGG - Intronic
980705585 4:136488803-136488825 CTCCACCCTGCTTTGTGACCTGG - Intergenic
981490673 4:145336270-145336292 CTCCTCACTCCTGTGTAACCTGG + Intergenic
981582405 4:146262983-146263005 TACTTCTCTGCTCTTTGACCTGG + Intronic
981747610 4:148066711-148066733 TTCTTATCTTCTGTGTGACCTGG + Intronic
984712411 4:182896675-182896697 CTCTTCTCCCCCTTGTGACCAGG + Intronic
984943474 4:184953557-184953579 CACTTACTTGCTGTGTGACCTGG - Intergenic
984987191 4:185342840-185342862 CTCTTCATGGCTGTGTGACCTGG + Intronic
985158935 4:187024113-187024135 CTCCACTCTGCTGTGTGCTCTGG + Intergenic
985557943 5:567074-567096 CTCTTCTCTGTGGTTTCACCCGG - Intergenic
985564223 5:607251-607273 CTCTGTCCTGCTGTGTGGCCAGG - Intergenic
986192637 5:5511245-5511267 CTCTTCTCTTCTGTGAAACAAGG + Intergenic
986252030 5:6068816-6068838 TTCTTCTCTGCTGTGAGACAGGG + Intergenic
986722114 5:10566712-10566734 TGCCTCTCTGCTGTGTGGCCTGG - Intronic
986923794 5:12720740-12720762 CTCTTAACTGCTGTGTGACATGG + Intergenic
988038918 5:25862613-25862635 CTTTCCTCTGATGTGGGACCAGG + Intergenic
989096656 5:37788201-37788223 CTCTTTTCAGCTGTTCGACCTGG + Intergenic
989558191 5:42820954-42820976 CTCTTCTGTGCTGGGCAACCTGG + Intronic
990294691 5:54389024-54389046 CTCTTCTGTGCTGTGTAATATGG + Intergenic
990334587 5:54759619-54759641 CTTTTCCCTGCTCTGTGTCCAGG - Intergenic
990513958 5:56515025-56515047 CTCTGTCCGGCTGTGTGACCTGG - Intronic
990566512 5:57034981-57035003 CACCTCTTTGCCGTGTGACCTGG - Intergenic
990811387 5:59728170-59728192 CTCTTCCAAACTGTGTGACCTGG - Intronic
992066600 5:73115443-73115465 CACTTACCAGCTGTGTGACCTGG - Intergenic
993042811 5:82835116-82835138 CTCTTCTCACCAGTGTGCCCTGG - Intergenic
993334799 5:86644794-86644816 TTCTTCTCTGCTATATGGCCAGG - Intergenic
995422034 5:111978502-111978524 ATCTACTCTGCTGTGTAACATGG + Intronic
997845189 5:137279577-137279599 CTCTTCTCTGTTGTTGCACCTGG - Intronic
998025838 5:138815480-138815502 CTCTTTCCTGCTGGGTGCCCTGG + Intronic
998365179 5:141625872-141625894 CTCTTCCCTGCTCTGAGCCCAGG + Intronic
998797241 5:145833659-145833681 CTCCTCACTCCTCTGTGACCAGG + Intronic
998846502 5:146315549-146315571 CTCTTCCAGGCTGTGTGACCTGG - Intronic
998997632 5:147883020-147883042 CTCTGCTCTGCTGTGTGTTGAGG + Intronic
999229095 5:150051125-150051147 CACTAATCTGCTGTGGGACCCGG - Intronic
999238916 5:150116140-150116162 CACTTCCCTGCTGTGTGAAGTGG - Intronic
999665028 5:153904075-153904097 CTCTGCTGTGCTCTGTGACTTGG - Intergenic
999702498 5:154240848-154240870 CGCTTCCTGGCTGTGTGACCTGG + Intronic
1000285130 5:159820091-159820113 CTCTGCTCTGCTGACTGTCCAGG - Intergenic
1001318381 5:170660816-170660838 GCCTTCACTGCTGTGTGTCCTGG + Intronic
1001533519 5:172481841-172481863 CTGCTTGCTGCTGTGTGACCTGG - Intergenic
1001590951 5:172864867-172864889 CTCTTACTTGCTGTGTGAGCCGG - Intronic
1001673145 5:173491030-173491052 CTCTGCCCTGCTCTGTGCCCTGG - Intergenic
1001777209 5:174337722-174337744 CCCTTCTCTTCTGTCTGGCCTGG + Intergenic
1002185519 5:177453050-177453072 CCCTTCTGAGCTGTGTGACCTGG + Intronic
1002706069 5:181161362-181161384 CCCATGTCTGCTGTGTGAGCAGG - Intergenic
1002871326 6:1169711-1169733 CCCTTCCCAGCTGTGTGACCCGG - Intergenic
1004122499 6:12838216-12838238 CTTTTCTCTTGTGTGTGAGCAGG - Intronic
1006447854 6:34090019-34090041 CTCTTACTTGCTGTGTGGCCTGG + Intronic
1006745578 6:36339620-36339642 CCCTTCAAGGCTGTGTGACCTGG - Intergenic
1008033750 6:46724738-46724760 CTCTTCTCTGTTCAGTGACTAGG - Intronic
1008219796 6:48842248-48842270 TTTTTCTCATCTGTGTGACCTGG + Intergenic
1011652463 6:89519250-89519272 CTTTTCTCTGCAGTATGACCAGG - Intronic
1012498685 6:99863981-99864003 CTCTTTCCTGCTATGTGAACTGG - Intergenic
1012600170 6:101086781-101086803 CTCTGCTCTGCTCTGTGCCCAGG - Intergenic
1012620874 6:101341906-101341928 TCCCTCTCTGCAGTGTGACCTGG + Intergenic
1012658236 6:101853232-101853254 CTCTTCTTAGCTATGTGACCTGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1014750625 6:125251993-125252015 CTCTTCTCTCCTGTGCTTCCGGG + Intronic
1015296797 6:131604086-131604108 TTGTTCTCTGCTGTGTCCCCAGG + Intronic
1016614722 6:146032593-146032615 GTCTTCTCTGCTATTTGACAGGG - Intronic
1017869998 6:158479102-158479124 GTCTTACCAGCTGTGTGACCTGG - Intronic
1017898153 6:158699257-158699279 CTCTTCTCTCCTGGGTGACTTGG - Intronic
1018420217 6:163634678-163634700 CTCTGCTCTGCTGGGTCCCCGGG + Intergenic
1018707070 6:166470934-166470956 CTCTTCTCGGATTCGTGACCCGG - Intronic
1018791777 6:167154317-167154339 CACTTCTTAGCTCTGTGACCTGG - Intronic
1018898084 6:168035164-168035186 CTCTTCTCGTCTGTGAGAGCGGG + Intronic
1019191311 6:170252535-170252557 CACTTCCCTTCTCTGTGACCTGG - Intergenic
1019590502 7:1828037-1828059 CTCTTATGTGCTGTGGGCCCCGG + Intronic
1020047585 7:5054000-5054022 TTCTTCCCTGCTCTGTGGCCTGG + Intronic
1022206646 7:28170889-28170911 CTGTTCTTTGCTCTGTGTCCTGG + Intronic
1023981323 7:45072289-45072311 GTGGTTTCTGCTGTGTGACCTGG + Intronic
1024941422 7:54767303-54767325 TTGCTCTCTGCTGTGTGGCCAGG + Intergenic
1025225616 7:57158888-57158910 CACTTATGGGCTGTGTGACCTGG - Intergenic
1025248337 7:57334751-57334773 CACCTCTTGGCTGTGTGACCTGG + Intergenic
1025267717 7:57478535-57478557 CACTTATGGGCTGTGTGACCTGG + Intergenic
1025749080 7:64275687-64275709 CACTTATGGGCTGTGTGACCTGG + Intergenic
1026300633 7:69094904-69094926 TTCCTGTTTGCTGTGTGACCTGG - Intergenic
1026792847 7:73346041-73346063 TTCATCTCTGCTGTGTGCCTTGG - Intronic
1027530635 7:79327113-79327135 CTCTTCTCATCTGTGTGACCTGG + Intronic
1029633525 7:101768478-101768500 CTCTGGCTTGCTGTGTGACCAGG - Intergenic
1030536407 7:110772336-110772358 CTCTTCTCTGCTGTCTGGTCAGG + Intronic
1030694731 7:112572376-112572398 CTCTTCTCTGCTCTGTGCCTAGG - Intergenic
1031045194 7:116879683-116879705 CACCTCCCTGCTGTGTGACCGGG + Intronic
1031529755 7:122862280-122862302 CTATTCTCTGCTCTGTGCCTTGG + Intronic
1032467464 7:132155261-132155283 CACCTCCCTGCTGTGTAACCTGG + Intronic
1033002669 7:137524645-137524667 CTTTTATCTGCTGTGTGTGCAGG - Intronic
1034269338 7:149796128-149796150 CTGTTCACTGCTGTGTCCCCAGG - Intergenic
1034556514 7:151853826-151853848 CTCTTCACTGCTGAGGAACCTGG + Intronic
1034956843 7:155340144-155340166 CTCTCCTCTCCGTTGTGACCTGG - Intergenic
1035046466 7:155970861-155970883 CACTCCTCTGCAGGGTGACCTGG + Intergenic
1035485876 7:159225724-159225746 CTGTGCTCTGCTCTGAGACCTGG + Intergenic
1036662523 8:10717054-10717076 CTTCTCTCTGCTTTGTGCCCTGG + Intergenic
1037492275 8:19407605-19407627 CTCTTACCTGCTGTGAGGCCTGG + Intronic
1038425857 8:27463315-27463337 CCCTTCTGGGCTGTGTGCCCCGG - Exonic
1039517869 8:38148327-38148349 CTCTCCTCGGCTGTGTATCCAGG - Exonic
1039738575 8:40358604-40358626 TTATTTTCTGCTTTGTGACCAGG + Intergenic
1039848996 8:41346206-41346228 CTTTTCTCTGGGGAGTGACCAGG - Intergenic
1041434575 8:57824095-57824117 CTCATCTCTGCTGTTTTAGCAGG - Intergenic
1041521822 8:58765209-58765231 CTCTTCTCCTCTGTGTTTCCAGG - Intergenic
1041785623 8:61629893-61629915 CACTTGTCAGCTCTGTGACCTGG + Intronic
1043361258 8:79475178-79475200 CTTCTCTCTGCACTGTGACCTGG - Intergenic
1043875126 8:85477214-85477236 CTCTTCTGGAATGTGTGACCTGG + Exonic
1044665236 8:94627978-94628000 CACTTCTTGGCTGTGGGACCTGG + Intergenic
1045478013 8:102569534-102569556 CTCTGCTCTGCTGTGGGCCCGGG - Intergenic
1046957293 8:120074687-120074709 CTCTTTTCTGCTGTGTCTCTAGG - Intronic
1047015094 8:120715803-120715825 CTCTCCACTGCTGTGTGAGTGGG - Intronic
1047111515 8:121794458-121794480 CACTTATCAGCTGTGTGACTTGG - Intergenic
1047307500 8:123664790-123664812 CACTTACCAGCTGTGTGACCTGG + Intergenic
1047381127 8:124364285-124364307 CTCTTTTCTGCTGTGTAAGGAGG - Intronic
1047739878 8:127797909-127797931 CTCTCCCAAGCTGTGTGACCTGG - Intergenic
1048318386 8:133378751-133378773 CCCTTCCGAGCTGTGTGACCTGG + Intergenic
1048352749 8:133629298-133629320 CCCTTCCCAGCTGTGTAACCTGG + Intergenic
1048456921 8:134586851-134586873 CACTTGTTAGCTGTGTGACCTGG + Intronic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1049741537 8:144243287-144243309 GTCTTCTCTGGAGTGTGACATGG + Intronic
1050448126 9:5749123-5749145 CACTACTCTGCTGGGTGAACTGG - Intronic
1051077498 9:13257324-13257346 CTTTTCTCTGTTGTGTTATCTGG - Intronic
1052354733 9:27492872-27492894 CTATTATTTGCTGTGTGGCCTGG + Intronic
1052986034 9:34488795-34488817 TTCTCATTTGCTGTGTGACCCGG + Intronic
1053410210 9:37911463-37911485 CCCTTTCCAGCTGTGTGACCTGG - Intronic
1054814462 9:69461679-69461701 CACTTCACAGCTGTGTGACCTGG - Intronic
1055127061 9:72730998-72731020 CACTTGCCTGCTGTGTGGCCTGG + Intronic
1056134736 9:83621111-83621133 CTCTTCCCTGCTCTGAGCCCAGG + Intergenic
1056948648 9:91023954-91023976 CTCTACTCTGCTCCGTGACTGGG + Intergenic
1057145905 9:92759531-92759553 CTCTGCTCTGCTGTGGGAGGTGG - Intronic
1057447493 9:95127569-95127591 CTCCTCTCCGCTGTGCGCCCAGG + Intronic
1059485888 9:114626570-114626592 CACTCATGTGCTGTGTGACCTGG - Intronic
1060013475 9:120065376-120065398 GTCTGCATTGCTGTGTGACCTGG - Intergenic
1060667265 9:125439345-125439367 CTCCCACCTGCTGTGTGACCTGG + Intronic
1060746016 9:126131420-126131442 CTCCTCTCAGCACTGTGACCAGG + Intergenic
1060994741 9:127869540-127869562 CTCTGTTCAGCTGTGTGACCTGG + Intronic
1061721435 9:132554091-132554113 CGCTTTCCAGCTGTGTGACCAGG - Intronic
1062015845 9:134290995-134291017 GTCTCCACTGCAGTGTGACCAGG + Intergenic
1062026532 9:134343165-134343187 CTTTTACATGCTGTGTGACCTGG + Intronic
1187098330 X:16168976-16168998 CTCAGCTCTGCTGTGCGCCCTGG + Intronic
1187206580 X:17187324-17187346 CTCTTCTTGGCTGTGTGCCCTGG - Intergenic
1187393235 X:18899268-18899290 CTCCTCTCTGCTGTGTCTCTTGG - Intronic
1187789981 X:22939947-22939969 CTCTGCTCTGCTCAGTGGCCTGG + Intergenic
1190199854 X:48351435-48351457 CTGGTCTCTGCTGTGTTACTGGG - Intronic
1190239458 X:48646132-48646154 ATATTTTCTGCTGTGTGGCCCGG + Intergenic
1190338288 X:49276404-49276426 CACCTATCAGCTGTGTGACCTGG - Intronic
1190522198 X:51291891-51291913 CACTTCCCAGCTGTGTGAACAGG + Intergenic
1190703142 X:53003085-53003107 CTCTTATTAGCTGTGTGACTGGG + Intergenic
1192183408 X:68930165-68930187 CTCTTCCTTGCTGGGTGATCTGG + Intergenic
1192220659 X:69195410-69195432 CTCATCTCTGCTGTCAGGCCCGG + Intergenic
1192985630 X:76395962-76395984 CTCTTCACTGCTGTCAGACAGGG + Intergenic
1195588284 X:106592270-106592292 TACTTCCCAGCTGTGTGACCTGG + Intergenic
1196071544 X:111529081-111529103 CATTTGTCAGCTGTGTGACCTGG - Intergenic
1196926928 X:120642578-120642600 CACTTCCTAGCTGTGTGACCTGG + Intergenic
1198052025 X:132959261-132959283 CTCTTTTCTGCTGCTGGACCAGG + Intronic
1198395312 X:136213741-136213763 CTCTTTCCAGCTGTGTGACCTGG + Intronic
1198477494 X:137009560-137009582 CTCTTCTCTTCTTTGAGACAGGG - Intergenic
1198557657 X:137812329-137812351 CTCCACTCTGCTTTGTGACCAGG - Intergenic
1199780127 X:151050891-151050913 CACTTAGCTGCTGTGTGACCTGG + Intergenic
1201942461 Y:19474499-19474521 CTCTTCACTGCTATGTGTCATGG + Intergenic