ID: 1174460347

View in Genome Browser
Species Human (GRCh38)
Location 20:50678112-50678134
Sequence ATGGTGGCTGGTTCTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174460347_1174460356 16 Left 1174460347 20:50678112-50678134 CCAAGAAGAGAACCAGCCACCAT No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460347_1174460353 -6 Left 1174460347 20:50678112-50678134 CCAAGAAGAGAACCAGCCACCAT No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460347_1174460351 -9 Left 1174460347 20:50678112-50678134 CCAAGAAGAGAACCAGCCACCAT No data
Right 1174460351 20:50678126-50678148 AGCCACCATGGGTGCTAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174460347 Original CRISPR ATGGTGGCTGGTTCTCTTCT TGG (reversed) Intronic