ID: 1174460353

View in Genome Browser
Species Human (GRCh38)
Location 20:50678129-50678151
Sequence CACCATGGGTGCTAAACCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174460346_1174460353 -5 Left 1174460346 20:50678111-50678133 CCCAAGAAGAGAACCAGCCACCA No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460347_1174460353 -6 Left 1174460347 20:50678112-50678134 CCAAGAAGAGAACCAGCCACCAT No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460345_1174460353 -4 Left 1174460345 20:50678110-50678132 CCCCAAGAAGAGAACCAGCCACC No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460340_1174460353 30 Left 1174460340 20:50678076-50678098 CCATCTCATTTTCTCAATCATCA No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460344_1174460353 -3 Left 1174460344 20:50678109-50678131 CCCCCAAGAAGAGAACCAGCCAC No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data
1174460343_1174460353 -2 Left 1174460343 20:50678108-50678130 CCCCCCAAGAAGAGAACCAGCCA No data
Right 1174460353 20:50678129-50678151 CACCATGGGTGCTAAACCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174460353 Original CRISPR CACCATGGGTGCTAAACCGG TGG Intronic