ID: 1174460356

View in Genome Browser
Species Human (GRCh38)
Location 20:50678151-50678173
Sequence GCTGATATAGCAAAGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174460344_1174460356 19 Left 1174460344 20:50678109-50678131 CCCCCAAGAAGAGAACCAGCCAC No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460346_1174460356 17 Left 1174460346 20:50678111-50678133 CCCAAGAAGAGAACCAGCCACCA No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460345_1174460356 18 Left 1174460345 20:50678110-50678132 CCCCAAGAAGAGAACCAGCCACC No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460347_1174460356 16 Left 1174460347 20:50678112-50678134 CCAAGAAGAGAACCAGCCACCAT No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460343_1174460356 20 Left 1174460343 20:50678108-50678130 CCCCCCAAGAAGAGAACCAGCCA No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460354_1174460356 -3 Left 1174460354 20:50678131-50678153 CCATGGGTGCTAAACCGGTGGCT No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460350_1174460356 4 Left 1174460350 20:50678124-50678146 CCAGCCACCATGGGTGCTAAACC No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data
1174460352_1174460356 0 Left 1174460352 20:50678128-50678150 CCACCATGGGTGCTAAACCGGTG No data
Right 1174460356 20:50678151-50678173 GCTGATATAGCAAAGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174460356 Original CRISPR GCTGATATAGCAAAGTGTGT TGG Intronic